... protein of D farinae may be associated with the pathogenesis of allergic diseases However, the functions of D farinae Pplase are unclear Here, we aim to determine the role of D farinae Pplase in the ... Signaling, USA (4964); an antibody against GAPDH was procured from Proteintech, China (104941-AP); a TLR4 signaling inhibitor was purchased from Invivogen, USA (CLI-095); an anti-mouse TLR2 Ab was ... published data indicate that D farinae contains Der f 1–23 subtypes of allergens, and Der f and are the major allergens5 Although there are many allergens in the air, such as those found in dust
Ngày tải lên: 04/12/2022, 15:54
... remains the basis of the whole network, they are liable for the study of data, processing data, store data and transmit data Lifetime expansion is one of the most significant analysis problems in ... Singh2 and Manoj Kumar3 Department of Computer, ARIS Cell, RPCAU, Pusa, India Department of Computer, VC Cell, RPCAU, Pusa, India Department of Computer, DoEE, RPCAU, Pusa, India *Corresponding author ... communication hardware, low duty cycle issues, system partitioning and energy-aware MAC protocols Several routing techniques, including data aggregation, clustering, many node role assignment and data-centric
Ngày tải lên: 17/03/2020, 19:54
Báo cáo hóa học: "Review Article Multicast Routing Protocols in Mobile Ad Hoc Networks: A Comparative Survey and Taxonomy Osamah S. Badarneh and Michel Kadoch" pdf
... established and maintained, multicast routing protocols are classified into the following two approaches (a) The Source-Initiated approach, in which a multicast group is initiated and maintained by ... block data packet acquires the address of the following node and unicasts the DDM block data packet Finally, the data packet reaches its destinations In this way, the protocol avoids maintaining ... Flat MZRP Hierarchy MCEDAR Hierarchy ITAMAR Flat PLBM Flat PPMA Flat ADMR Network Flat MAODV Flat AMRIS Flat MMAs Hierarchy ASTM Hierarchy ODMRP Flat DCMP Flat FGMP Flat CAMP Flat NSMP Flat ACMRP
Ngày tải lên: 21/06/2014, 22:20
Báo cáo sinh học: " Contrast enhancement of stimulus intermittency in a primary olfactory network and its behavioral significance" pdf
... Percentage Percentage Percentage aaa a a a a a b a a b a a b aaa a b a a aa a aa aaa aaa aa a a a a a aa (e) Pheromone Solvent control Saline injection Bicuculline injection (f) -180 -120 -60 ... pinned to a wax-coated glass Petri dish with the ALs facing upward Tracheae and a small part of the sheath overlying one AL were... earlier, the dual-channel Axoprobe- 1A amplifer, a ... linear DC amplifier, and Datapack 2k2 system were used to achieve the simultaneous recordings Data acquisition and analysis Spike traces were digitized at 25 kHz sampling rate using Datapack
Ngày tải lên: 06/08/2014, 18:21
Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt
... University of Saskatchewan, Saskatoon, Saskatchewan, Canada and 2 Department of Computer Science, College of Arts and Science, University of Saskatchewan, Saskatoon, Saskatchewan, Canada Email: David ... accumulated mean viral load as our main measure of infection prevalence. The accumulated mean viral load, A v (t), in the population was the integral of the mean viral load from the beginning of a ... resulted in an increase in a person's viral load. It bears noting that, increasing the viral load incoming from a person's neigh- bour also appeared to have a similar effect on the timing of
Ngày tải lên: 13/08/2014, 16:21
Approximation to the stationary distribution of information flows in a communication network
... normal data models using Gibbs sampling”.J.Amer.Statist.Assoc. 85,972-985. [27] Gelfand, A. and Smith, A. (1990). “ Sample based approaches to calculating marginal densities”.J.Amer.Statist.Assoc. ... SOLUTION 6.1 57 Networks with analytical solution In this section, we consider three networks where exact analytical solutions are available, which are the standard (that is of unit capacity link) linear network, ... transmitting communication network such as the Internet is once again a hot topic today. In recent years, the increasing volume of digital file transmitting in the network and the heavy visiting
Ngày tải lên: 30/09/2015, 14:16
Packet level quality of service analysis of multiclass services in a WCDMA mobile network
... that contains l packets t finish,i Finishing transmission time of the ith packet within a Pareto... simultaneous satisfaction of the QoS constraints in all layers The QoS parameters at ... R Fantacci and A Naldi, “Performance evaluation of a CDMA protocol for voice and data integration in personal communication networks,” IEEE Transactions on Vehicular Technology, vol 49, Mar 2000, ... [7] I.B Bdira and A.K Elhakeem, “A radio-link protocol analysis of integrated CDMA networks a comparison with TDMA,” 5th IEEE international conference on universal personal communications, vol
Ngày tải lên: 27/11/2015, 12:39
A study of signal functions of reporting verbs in english and vietnamese
... of the characters As a result, in Vietnamese data, more translated translated version of an English verb are found 4.3.4 Signal Functions of Showing the Speaker’s Manner in English and Vietnamese ... differently compared with native speaker of English, and also can shed light on pedagogical implication of teaching and learning translation to Vietnamese learners of English vii LIST OF TABLES Page number ... VIETNAM ACADEMY OF SOCIAL SCIENCES GRADUATE ACADEMY OF SOCIAL SCIENCES Hoàng Tú Uyên ENGLISH LANGUAGE A STUDY OF SIGNAL FUNCTIONS OF REPORTING VERBS IN ENGLISH AND VIETNAMESE MA THESIS IN ENGLISH
Ngày tải lên: 05/06/2018, 14:18
A study of signal functions of reporting verbs in english and vietnamese
... of the characters As a result, in Vietnamese data, more translated translated version of an English verb are found 4.3.4 Signal Functions of Showing the Speaker’s Manner in English and Vietnamese ... differently compared with native speaker of English, and also can shed light on pedagogical implication of teaching and learning translation to Vietnamese learners of English vii LIST OF TABLES Page number ... VIETNAM ACADEMY OF SOCIAL SCIENCES GRADUATE ACADEMY OF SOCIAL SCIENCES Hoàng Tú Uyên ENGLISH LANGUAGE A STUDY OF SIGNAL FUNCTIONS OF REPORTING VERBS IN ENGLISH AND VIETNAMESE MA THESIS IN ENGLISH
Ngày tải lên: 18/05/2021, 12:44
A dynimic model of user behaviour in a social network site
... of Texas at Austin watson@eco.utexas.edu April 16, 2010 Abstract This paper estimates a dynamic model of user behavior in a social network site using unique data on the daily login activity of ... features of a social network site affect usage, and to evaluate counterfactual policies that are managerially relevant As their popularity grows among consumers, social network sites are attracting ... creating social interactions between the owner and her friends Using a social network site may have two effects on this stock of capital: (1) maintaining the quality of interactions with an existing
Ngày tải lên: 27/01/2022, 16:59
Optimization of Task Allocation in a Cluster–Based Sensor Network
... Optimization of Task Allocation in a Cluster–Based Sensor Network Mohamed Younis*, Kemal Akkaya and Anugeetha Kunjithapatham Department of Computer Science and Electrical Engineering University of ... periodicity of the sensor readings can lead to processing at half of the sampling frequency and thus losing 50% of the accuracy of the reported tracks of some targets Since the feasibility of an allocation ... For example, a job for target tracking consists of sensors’ data collection, data routing (if needed) and data processing tasks We formulize the problem of task allocation among gateways as an optimization
Ngày tải lên: 18/10/2022, 14:53
Estimating preferred departure times of road users in a large urban network
... what the traveller can control An advantage of using PAT is that disutility of travel time variability (TTV) can naturally be taken into account Fosgerau and Karlstroăm (2010) show that defining ... engineering applications has been the run-time of the estimation of PDT profiles In this application, calculating a PDT profile for each OD pair and trip purpose combination using the software Matlab and ... measures of peakiness and by applying the 123 Transportation model to the Stockholm congestion charging scheme and validating the outcome against measurements The measure of peakiness change as expected
Ngày tải lên: 24/11/2022, 17:44
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... Annals of Mathematics The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks By Tobias H Colding and William P Minicozzi II Annals of Mathematics, ... together along an axis GRAPHICAL OFF THE AXIS 31 BR A B C Figure 4: Proving Theorem 0.2 A Finding a small N -valued graph in Σ B Extending it in Σ to a large N -valued graph C Extending the number of ... surfaces of fixed genus in a 3-manifold III; Planar domains, Ann of Math., to appear; math.AP/0210141 [CM6] ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold IV; Locally simply
Ngày tải lên: 14/03/2014, 22:20
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... (n=36) of physicians fail to notify the health authority regarding pulmonary TB cases because of the lack of awareness among 53% (n=20) and because of paperwork involved in 26% (n=10) of respondents. ... Drug-resistant tuberculosis cases have been increasing in number and have reached as high as 32% from reports from tertiary referral hospitals. 3 Physicians play a key role in the diagnosis and management ... knowledge, attitudes and practices of specialist physicians in a tertiary–care hospital as to: a. their idea of the magnitude of TB problem in the Philippines b. their opinion of the National TB
Ngày tải lên: 15/03/2014, 03:20
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
... glycolytic pathway. Much effort has already been invested in mathematical modelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasite that causes ... V max parameters was used as the base model for parameter scanning using routines contained in GEPASI . METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format ... multivariate and machine learning approaches are appropriate for such problems, and so we used the evolutionary programming algorithms incorporated in the metabolic modelling package GEPASI [14–16]
Ngày tải lên: 17/03/2014, 11:20
An Analysis of Power Consumption in a Smartphone doc
... the command line For interactive applications, such as web browsing, we took a trace-based approach A trace consisted of a sequence of input events, including a time-stamp, the name of the device ... benchmark is trace-based, and includes loading the dialer application, dialing a number, and making a 57-second call The dialled device was configured to automatically accept the call after 10 sec- ... browsing Finally, the PMD (portable media device) case represents extensive media playback The parameters of these patterns are summarised in Table 12 In each case, GPRS is used for data networking
Ngày tải lên: 23/03/2014, 13:20
Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx
... in output Share of taxes in output Share of total bene ts in output Capital-output ratio Share of real balances in output... with an increase in Third, as regards the quantitative ... utility of agents in Gertler (1999), real balances can be included as an additional variable without creating an extra analytical burden. As we derive below, the solutions for the value functions of ... rule Inertial parameter in interest rate rule In ation... ratio constant This drop in the replacement rate strongly increases savings incentives in working age, as can be inferred
Ngày tải lên: 29/03/2014, 13:20
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt
... Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X6A) or Met-Gly-Xaa-Ala-Ala-Ser-AlaAla-Ala-Ala (Myr–AGG1-3X6S), with position of each motif separately occupied by each of the 20 amino acids (Fig 3A) ... mature AGG1 fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala was amplified by PCR with the primers AGG1 ... N-terminus to the myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Lys-Ala-AlaAla (Myr–AGG1-3X6A7K) or Met-Gly-Xaa-AlaAla-Ser-Lys-Ala-Ala-Ala (Myr–AGG1-3X6S7K) (B, C) Each of the 20 mRNAs corresponding
Ngày tải lên: 29/03/2014, 21:20
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG Gamma 2 AGGTVMAACTGCAGVAGTCWGG Gamma 3 AGGTVVAGCTGCAGVAGTCWGG Gamma 4 ACTGCAGGTRTCCACTCC Gamma 5 RCTACAGGTGTCCACTCC Gamma 6 GCYACAGMTGTCCACTCC Gamma 7 ACTGCAGGTGTCCTCTCT ... ACTGCAGGTGTCCTCTCT Gamma 8 RCTRCAGGYGTCCACTCT Gamma 9 CCAAGCTGTGTCCTRTCC Gamma 10 TGTTGACAGYCVTT CCKGGT Gamma 11 TAYTTTAAAARGTGTCMAGTGT Gamma 12 CTYTTAAAAGGKGTCCAGWG Gamma 13 CYTTTAMATGGTATCCAGTGT Gamma 14 ATGGCAGCWGCYCAAAG ... GGTGATATCWTGMTGACCCAAWCTCCACTCTC Kappa 3 GGTGATATCGTKCTCACYCARTCTCCAGCAAT Kappa 4 CTGWTGTTCTGGATTCCTG Kappa 5 GTGCTCTGGATTCGGGAA Kappa 6 TCAGCTTCYTGCTAATCAGTG Kappa 7 TGGGTATCTGGTRCSTGTG Kappa 8 GTTTCMAGGTRCCAGATGT
Ngày tải lên: 18/06/2014, 22:20