... algebraic expression of the theorem of Apollonius which asserts that the sum of the areas of the squares on the sides of a parallelogram equals the sum of the areas of the squares on the diagonals ... perpendicular to all elements of A Finally, we will write A for the set of all v which satisfy v ⊥ A Notice that A is always a linear subspace of V , for any A Now let M be a (linear) subspace of V ... real numbers We now deal with the complex case If B is a complex normed vector space, then it is also a real vector space, and the real and imaginary parts of a complex linear function are real...
Ngày tải lên: 31/03/2014, 15:23
... of Mathematics University of Michigan Ann Arbor Ml 48109 USA USA S Axler P R Halmos Department of Mathematics Santa Clara University Santa Clara CA 95053 USA Mathematics Subjects Classifications ... Principles of Random Walk 2nd ed WERMER Banach Algebras and Several Complex Variables 2nd ed KELLEY/NAMIOKA et al Linear Topological Spaces 37 MONK Mathematical Logic 38 GRAUERT/FRtTZSCIIE Several Complex ... here In particular, as an easy consequence of the Cauchy-Riemann equations, or rather a reformulation of the result that a function is analytic if and only if ita real and imaginary parts satisfy...
Ngày tải lên: 12/06/2014, 16:25
The Integration of Functions of a Single Variable, by G. H. Hardy pptx
... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... as real or complex functions of a real variable The functions with which we shall be dealing will always be such as are regular except for certain special values of x These values of x we shall ... INTEGRATION OF ELEMENTARY FUNCTIONS SUMMARY OF RESULTS The integral of a rational function (iv.) is always an elementary function It is either rational or the sum of a rational function and of a...
Ngày tải lên: 28/06/2014, 19:20
NORMAL FAMILIES OF MEROMORPHIC MAPPINGS OF SEVERAL COMPLEX VARIABLES FOR MOVING HYPERSURFACES IN A COMPLEX PROJECTIVE SPACE
... situation (for example Lemma 3.14 is an adaptation of our Lemma 3.6) Basic notions 2.1 Meromorphic mappings Let A be a non-empty open subset of a domain D in Cn such that S = D − A is an analytic ... and K I Virtanen, Boundary behaviour and normal meromorphic functions, Acta Math., 97 (1957), 47-65 [6] P N Mai, D D Thai and P N T Trang, Normal families of meromorphic mappings of several complex ... Families of normal maps in several complex variables and hyperbolicity of complex spaces, Complex Variables, 48 (2003), 469-482 [19] Z Tu, Normality criterions for families of holomorphic mappings of...
Ngày tải lên: 16/10/2015, 14:09
Bipolar Disorder – A Portrait of a Complex Mood Disorder Edited by Jarrett Barnhill docx
... signaling and a elevated protein kinase A activity ( Langan & McDonald 2009 ) The calcium channels antagonists (verapamil and others) raise carbamazepine effect Magnesium, acting like a natural calcium ... increases the verapamil maintenance therapy in mania (Giannini et al 2000) This fact favors the idea that an increase in magnesium concentration is an important fact, maybe essential for the therapeutic ... of Action 57 Carla P Fonseca, Liliana P Montezinho and M Margarida C .A Castro Chapter Memantine: A New Mood Stabilizer for Treatment-Resistant Bipolar Disorders 99 Gino Serra, Giulia Serra, Alexia...
Ngày tải lên: 08/03/2014, 00:20
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... Functional study of crustacean neuropeptide S H.-K Tiu and S.-M Chan in the stimulation of gonad maturation Injection of protein extract from thoracic ganglion or the brain can stimulate gonad maturation ... feriatus: hepatopancreas-specific expression and farnesoic acid stimulation of vitellogenin gene expression Mol Reprod Dev 70, 288–300 Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V, Jasmani...
Ngày tải lên: 16/03/2014, 05:20
Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx
... an upfront payment for future royalties Royalties earned on the book’s sales are offset against the advance and only once the book generates more royalties than the value of the advance are additional ... typically calculated per listener hour However, there are a wide variety of royalty arrangements e.g royalties may also be a fixed amount per track play or a percentage of revenue generated As ... show games for a period, and these broadcast royalties are then shared among the teams Issue: 4 MIAG 11 “Is a licensor's advance a financial and monetary liability?” 12 MIAG Issue: Accounting...
Ngày tải lên: 29/03/2014, 20:20
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
... Kanbayashi and Toyoshi Hosokawa Preface Understanding the rapid changes in the evaluation and management of peripheral neuropa‐ thies, as well as the complexity of their mechanism, is a mandatory ... Hosokawa, Lauren E Ta, Emily Ramirez, Anthony Windebank, Charles Loprinzi, Kathrine Jáuregui-Renaud, Sabatino Maione, Enza Palazzo, Javier Lopez-Mendoza, Alexandro Aguilera Salgado, Chengyuan Li ... dosing of ALA presented only marginal benefit; this significantly precludes the oral application of ALA Although ALA has been marketed in Germany for treating DPN and is available as nutritional...
Ngày tải lên: 30/03/2014, 23:20
báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx
... combines training of the hand and arm into an integrated task-based simulation This unique training modality is practical and accommodates and safely challenges subjects with a range of hand impairments ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding the variability among ... 10 Day Figure Daily Average Fractionation Scores During Training Daily Average Fractionation Scores During Training Upper Panel: Fractionation Average daily fractionation for Subjects S1, S2 and...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "HAJEK-RENYI-TYPE INEQUALITY FOR SOME NONMONOTONIC FUNCTIONS OF ASSOCIATED RANDOM VARIABLES" potx
... random variables, Journal of Statistical Planning and Inference 97 (2001), no 2, 201–225 [6] J Esary, F Proschan, and D Walkup, Association of random variables, with applications, Annals of Mathematical ... for associated random variables and the percolation model, The Annals of Probability 12 (1984), no 2, 514–528 [5] I Dewan and B L S Prakasa Rao, Asymptotic normality for U-statistics of associated ... random variables Prakasa Rao [13] proved a strong law of large numbers for associated sequences as a consequence of the Hajek-Renyi-type inequality Marcinkiewicz-Zygmundtype strong law of large...
Ngày tải lên: 22/06/2014, 22:20
BIPOLAR DISORDER – A PORTRAIT OF A COMPLEX MOOD DISORDER docx
... signaling and a elevated protein kinase A activity ( Langan & McDonald 2009 ) The calcium channels antagonists (verapamil and others) raise carbamazepine effect Magnesium, acting like a natural calcium ... increases the verapamil maintenance therapy in mania (Giannini et al 2000) This fact favors the idea that an increase in magnesium concentration is an important fact, maybe essential for the therapeutic ... of Action 57 Carla P Fonseca, Liliana P Montezinho and M Margarida C .A Castro Chapter Memantine: A New Mood Stabilizer for Treatment-Resistant Bipolar Disorders 99 Gino Serra, Giulia Serra, Alexia...
Ngày tải lên: 27/06/2014, 11:20
Báo cáo toán học: "Stability of the index of a complex of Banach spaces " pot
Ngày tải lên: 05/08/2014, 09:46
Báo cáo y học: "Systematic review of safety and tolerability of a complex micronutrient formula used in mental healt" pptx
... Community Health Sciences, University of Calgary, Calgary, Alberta, Canada 7Behavioural Research Unit, Alberta Children’s Hospital, 2888 Shaganappi Trail NW, Calgary, AB T3B 6A8 Canada Page of Authors’ ... Calgary, Calgary, Alberta, Canada 2Behavioural Research Unit, Alberta Children’s Hospital, Calgary, Alberta, Canada 3San Diego, California, USA Department of Agricultural, Food and Nutritional Science, ... University of Alberta, Edmonton, Alberta, Canada 5Department of Medicine, University of Calgary, and Foothills Medical Center, Calgary, Alberta, Canada 6Department of Pediatrics and Department of Community...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx
... found that Argentinean B and F sequence fragments in the HIV database can cover a full HIV-1 genome of each subtype, meaning that there was a potential to form any BF recombinants in Argentina and ... (01_AE and 02_AG) with ancestral lineages of subtypes A and G AIDS Res Hum Retroviruses 2007, 23:1008-1019 58 Yang R, Kusagawa S, Zhang C, Xia X, Ben K, Takebe Y: Identification and characterization ... Thailand and Myanmar (Additional file Fig S 2A) ; this occurred possibly through drug trafficking routes [26,28] Other Asian countries, for instance, Korea, Japan, and Thailand, appeared to have...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
Ngày tải lên: 26/10/2012, 10:04
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation:...
Ngày tải lên: 10/04/2013, 14:46