full length transcriptome analysis using a bias free cdna library prepared with the vector capping method
Báo cáo hóa học: " Research Article Advances in Modal Analysis Using a Robust and Multiscale Method" ppt
Ngày tải lên :
21/06/2014, 08:20
... automatically taken into account, as well as the spatial distribution of the material through the Li matrices As a result, full cells are heavier and stiffer than partially empty cells, and the matrices ... with the sounds synthesized with the tetrahedral FEM and the hexadedral FEM approaches (see additional material (http://www-sop.inria.fr/members/ Cecile.Picard/Material/AdditionalMaterialEurasip.zip)) ... As an example, the actual cost of computing the partial eigenvalue decomposition using a tetrahedralization in the case of a bowl with 274 vertices and generating 2426 tetrahedra is minutes with...
- 12
- 438
- 0
Báo cáo y học: "Near full-length genome analysis of low prevalent human immunodeficiency virus type 1 subclade F1 in São Paulo, Brazil" docx
Ngày tải lên :
12/08/2014, 04:21
... State, Brazil AIDS 2008, 22:433-435 Santos AF, Sousa TM, Soares EA, Sanabani S, Martinez AM, Sprinz E, Silveira J, Sabino EC, Tanuri A, Soares MA: Characterization of a new circulating recombinant ... draft of the manuscript ÉRP conducted the characterization of the fulllength genome analysis WKN help with the laboratory work CCB, KTF, EMNK and SF performed the initial characterization of samples ... 11.2% and 12.3% was observed among F1 strains from SAm, Romania and Central Africa, respectively Amino acids and LTR nucleotides alignment features Detailed inspection of the amino acid alignment...
- 11
- 280
- 0
Báo cáo sinh học: " Restricted maximum likelihood to estimate variance components for animal models with several random effects using a derivative-free algorithm" pdf
Ngày tải lên :
14/08/2014, 20:20
... of analysis may involve two random effects for each animal Let m, of length NA, denote the second animal effect and assume each element has variance a If there are repeated records per animal ... a given set of data, model of analysis and parameters to be estimated Estimating variance components for unbalanced data generally requires iterative schemes Standard textbooks on numerical analysis ... more robust against bad starting values more Quadratic approximation a model with animals as the only random effect, Graser et al (1987) fitted a quadratic function in r 0,2!la2 E to the log likelihood,...
- 24
- 304
- 0
SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH
Ngày tải lên :
08/09/2015, 15:34
... interaction and gives as output the multimodal behavioral streams associated with each person; the social interaction analysis maps the multimodal behavioral streams into social signals and social ... Traditional social interaction analysis work makes use of the existing facilities such as the web cameras and surveillance cameras in the physical space Also, the existing social interaction analysis ... mathematically formalized and practically implemented However, these methods not have the ability to capture the semantic meaning of activities, such as the spatial and temporal relationship among...
- 161
- 348
- 0
SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH
Ngày tải lên :
30/09/2015, 09:22
... Traditional social interaction analysis work makes use of the existing facilities such as the web cameras and surveillance cameras in the physical space Also, the existing social interaction analysis ... mathematically formalized and practically implemented However, these methods not have the ability to capture the semantic meaning of activities, such as the spatial and temporal relationship among ... wearable camera’s data for their analysis, in which each observation only has a limited field of view, and can only capture a portion of the social interaction In addition to wearable cameras,...
- 161
- 357
- 0
Transcriptome analysis using RNA seq on response of respiratory cells infected with porcine reproductive and respiratory syndrome virus (PRRSV)
Ngày tải lên :
25/11/2015, 15:23
... Material and Methods 25 STARLAB GmbH, Hamburg StarPure Agarose USB, Ohio, USA ExoSAP-IT VWR International GmbH, Ethanol absolute AnalaR NORMAPURđ ACS Darmstadt 3.1.2 Buffer, reagents and media ... investigate the animals scientifically After the animals had been euthanized at the research station, their thorax were opened and the lungs in total, inclusive with the trachea were carefully removed and ... migration of immune cells at basically any stage of an immune response (Kindt et al 2007, Tizard 2013) Alveolar macrophages (AM) are abundant in the lung and have a special role there as well as...
- 165
- 416
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
Ngày tải lên :
17/03/2014, 03:20
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT -cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full- length cDNA clones, GT -cDNA1 and GT -cDNA The two putative polyadenylation sites (ATTAAA) are ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT -cDNA1 and another is located 11 bp upstream from the poly (A) of GT -cDNA2 (data not...
- 8
- 465
- 0
Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot
Ngày tải lên :
17/03/2014, 20:20
... produced after transfer, and make appropriate pragmatic decisions RELATING SURFACE AND ABSTRACT SPEECH ACTS A problem in translating dialogues is to translate adequately the speaker's communicative ... structure the English 2a~ Aarld new PROP symbols in the translate.act, txans-speaker and trans-hearer slots [japanese: JASA [speech-act-type: #sat~EQUEST, manner: #man=DIRECT, speaker: # j-sp-J-SPEAK~ ... predicate and the object being touched is a spatial destination in Japanese (perceived as a goal or a target) and an object in English I INPUT : a structure representing a deep analysis of the...
- 6
- 264
- 0
báo cáo khoa học:" Applied mechanics of the Puricelli osteotomy: a linear elastic analysis with the finite element method" doc
Ngày tải lên :
12/08/2014, 00:20
... Group I was cut with a carburundum disk, as in the original Obwegeser-Dal Pont technique for sagittal osteotomy of the mandibular ramus One of the splits was perpendicular to the mandibular ramus ... long axis, 13 mm from the mandibular incisure, another was parallel to the external oblique line, mm lingual to it, and the third cut was 23 mm proximal to the distal border of the mental foramen, ... condylar processes and a unitary stress was applied to the mental region A similar method was used by Kroon et al [9] in an experimental in vitro model with polyurethane mandibles Additional traction...
- 7
- 301
- 0
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc
Ngày tải lên :
12/08/2014, 02:20
... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The probe ... statistical analysis SC conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author details Laboratory of Marine Genetics and ... probe was labeled with 6carboxyfluorescein (FAM) at the 5’-end and with BHQ1 at the 3’-end Preparation of standard plasmid DNA PCR amplification of the NS1 gene was carried out in a reaction...
- 4
- 587
- 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
Ngày tải lên :
12/08/2014, 03:20
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
- 11
- 275
- 0
AN1184 using a timer to interface 8051 MCUs with UNIO® bus compatible serial EEPROMs
Ngày tải lên :
11/01/2016, 16:48
... NoMAK after the byte is read To continuously read the array, the MCU generates a MAK after each data byte The serial EEPROM responds with a SAK if there are no errors FIGURE 10: BYTE READ (DATA ... shows the transmission of the low address byte and the data byte, as well as the NoMAK and SAK FIGURE 6: DATA BYTE AND STOP BIT SCIO Data Byte NoMAK SAK Word Address LSB MAK SAK Insert Image Here ... and another MAK The serial EEPROM then responds with a SAK if the start header and device address were received correctly Figure shows the details of the start header and the device address The...
- 16
- 279
- 0
AN1187 using a timer to interface PIC18 MCUs with UNIO® bus compatible serial EEPROMs
Ngày tải lên :
11/01/2016, 16:48
... request data At the end of the array, the internal word address is automatically reset back to 0x000 A NoMAK terminates the operation Reading Data Back After the read command and word address have ... DS01187B-page AN1187 PAGE READ Command and Word Address for Read The serial EEPROM allows data to be read from the array in a random access manner Reading data from the array is very similar to the ... Inc AN1187 Once all data bytes have been sent, the MCU terminates the command by generating a NoMAK in place of the MAK, and the serial EEPROM again responds with a SAK This also initiates the...
- 14
- 450
- 0
Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt
Ngày tải lên :
07/03/2014, 18:20
... elements contain information about the characters who speak and what they said at each dialogue turn On the other hand, context elements contain all the additional information (explanations and descriptions) ... representations for each full dialogue stored in the dialogue database are computed and used along with the utterance-level score for generating a final rank of candidate utterances A log-linear combination ... terms are identified, they are automatically replaced by the placeholders and , respectively In the case of a mature dialogue, when there are more terms into the vocabulary...
- 6
- 498
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 1830–1881 of the MARCKS cDNA [38] and cloning the resulting doublestranded ... to audioradiography with Kodak X-OMAT AR X-ray film Northern blot analysis Cultures were washed twice with ice-cold NaCl/Pi and cellular RNA was extracted using the RNeasy Total RNA kit (Qiagen) ... (+PDB) Total RNA was isolated and lg loaded on a 1.2% (w/v) formaldehyde/agarose gel for Northern blot analysis as described in legend to Fig 6A The degradation of the MARCKS mRNA by activation of...
- 16
- 754
- 0
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx
Ngày tải lên :
22/03/2014, 16:21
... Schwalbach, Germany) Activity assay For analysis of the catalytic activity of SGRSGRSG-RATE in comparison with that of RNase A, a fluorometric assay employing the low molecular mass substrate FAM-AUAA-T ... (Figs and S1) revealed that the linkers not constrain the ability of the RNase A entities to adopt the same orientation in the crystal as monomeric RNase A On the other hand, the decreased activity ... of the RATEs as compared with RNase A ([16] and Table 1) indicate a negative influence of the tandemization on the catalytic efficiency The recovery of activity after proteolytic cleavage of the...
- 10
- 535
- 0
Báo cáo hóa học: " Research Article On a New Hilbert-Type Intergral Inequality with the Intergral in Whole Plane" pdf
Ngày tải lên :
21/06/2014, 07:20
... Journal of Inequalities and Applications Both of them are important in Mathematical Analysis and its applications It attracts some attention in recent years Actually, inequalities 1.1 and 1.2 have ... parameters,” Acta Mathematica Sinica, vol 49, no 5, pp 1121–1126, 2006 17 I Brneti´ and J Peˇ ari´ , “Generalization of Hilbert’s integral inequality,” Mathematical Inequalities and c c c Application, ... Xie, A new reverse Hilbert-type inequality with a best constant factor,” Journal of Mathematical Analysis and Applications, vol 343, no 2, pp 1154–1160, 2008 12 B Yang, A Hilbert-type inequality...
- 8
- 319
- 0
Báo cáo hóa học: " Research Article On a Multiple Hilbert-Type Integral Inequality with the Symmetric Kernel" docx
Ngày tải lên :
22/06/2014, 18:20
... an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol 321, no 1, pp 182–192, 2006 [3] I Brneti´ and J Peˇ ari´ , “Generalization of inequalities of Hardy-Hilbert ... (r,s), and two parameters α, λ As applications, the equivalent form, the reverse forms, and some particular inequalities are given We also prove that the constant factors in the new inequalities are ... Journal (Natural Science and Medical Edition), vol 28, no 1, pp 20–23, 2007 (Chinese) [5] B Yang and L Debnath, “On the extended Hardy-Hilbert’s inequality,” Journal of Mathematical Analysis and Applications,...
- 17
- 276
- 0
Báo cáo hóa học: " Research Article A Multiple Hilbert-Type Integral Inequality with the Best Constant Factor" doc
Ngày tải lên :
22/06/2014, 18:20
... inequality and its applications,” Mathematica Applicata, vol 16, no 2, pp 82–86, 2003 [10] Y Hong, “All-sided generalization about Hardy-Hilbert integral inequalities,” Acta Mathematica Sinica Chinese ... Jichang and L Debnath, “On new generalizations of Hilbert’s inequality and their applications,” Journal of Mathematical Analysis and Applications, vol 245, no 1, pp 248–265, 2000 [5] K Jichang, Applied ... Inequalities, Shandong Science and Technology Press, Jinan, China, 2004 [6] B G Pachpatte, “On some new inequalities similar to Hilbert’s inequality,” Journal of Mathematical Analysis and Applications,...
- 14
- 146
- 0