from mr byecorf at augsburgh
The Country Housewife and Lady''''s Director potx
Ngày tải lên :
31/03/2014, 16:20
... salted for boiling immediately, from the Shambles From Mr J P Chymist 117 Potatoe−Puddings, made with Sweet−meats From Mr Moring, Temple−Bar 118 Potatoe−Pudding baked From Mr Shepherd of Windmill−Street ... that are sick, in the Summer From the same • Lisbon or Portugal−Cakes From the same, • Imperial Florentine From Mr Byecorf at Augsburgh • To make Farced Meat, for the foregoing Florentine From ... From Mr Renaud • Calf's Liver stuffed and roasted From the same • To roast a Calf's Liver, another way From Mrs M N • Cream Custard From Lady H • To imitate the fat Livers of Capons roasted From...
- 130
- 676
- 0
SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx
Ngày tải lên :
15/03/2014, 13:20
... grievances—their unfair taxation; no education for their children except in Dutch; no representation in Parliament—and this in a population in which, at that time, the English and Afrikanders at Johannesburg ... theirs, Mr H.C Perkins, the celebrated American mining expert This gentleman was a great friend of Randolph's, and he spoke most touchingly of his great attachment to the latter, and of his grief at ... staring at him with open eyes An attractive attribute was his love of his early associations, his father especially being often the theme of his conversation He used freely to express his admiration...
- 212
- 315
- 0
ASSESSMENT OF EXPLOSIVE DESTRUCTION TECHNOLOGIES FOR SPECIFIC MUNITIONS AT THE BLUE GRASS AND PUEBLO CHEMICAL AGENT DESTRUCTION PILOT PLANTS ppt
Ngày tải lên :
22/03/2014, 10:20
... TDC operations at Porton Down showed that one detonation every 35 minutes is possible A 35-minute cycle would correspond to 17 detonations per 10-hour shift At this rate, 882 days of operation ... neutralization reactors (ANRs) Energetics batch hydrolyzers (EBHs) Metal parts treater (MPT) Offgas Energetics hydrolysate Agent hydrolysate Supercritical water oxidation (SCWO) Energetics hydrolysate ... National Academies Press UXB International Incorporated 2007 Static Detonation Chamber Testing Using a Dynasafe SDC 2000, Final Report Blacksburg, Va.: UXB International Incorporated 2 Evaluation...
- 135
- 453
- 0
The research about remodeling and collecting gas from Imhoff tank at Dalat’s sewage treatment factory
Ngày tải lên :
18/11/2013, 16:38
... methods of waste water: method of gravity flowing Model is placed negative down, so the water level in the distributing hole higher than model’s water level From then, water flows from Φ 0.5cm pipes ... 2.4.The location of model and the method of operating The location of model: discharge – conditioning valve of Imhoff system tank’s input distributing hole in Da Lat waste water treatment factory ... day from the model Figure Sample chromatograms 3.2 The results of analysis of methane concentration in the gas mixture generated from the model Table The results of analysis of methane concentration...
- 6
- 434
- 0
Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx
Ngày tải lên :
18/02/2014, 00:20
... American Public Benefits from Internet Access at U.S Libraries that result from access to computers, the Internet, and related services at public libraries? What correlations can be made between ... came from the undergraduate Informatics program, as well as from the Master in Library and Information Science and the Master of Science in Information Management Program, and the Information ... demographic variables? What computer and Internet services and resources are lacking at public libraries that, if provided, could bring about greater benefit? What indicators of negative impact can be...
- 212
- 1.4K
- 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
Ngày tải lên :
18/02/2014, 08:20
... confocal microscope with excitation at 488 nm ⁄ emission at 505–535 nm for green, excitation at 543 nm ⁄ emission at 560–620 nm for red, and excitation at 647 nm ⁄ emission at 660–750 nm for pseudo-color ... estimated from the position of the sedimentation markers Enzymatic activities are expressed in arbitrary units, and representative sedimentation profiles are shown (D) Sections from adult rat tibialis ... The plate was blocked by NaCl ⁄ Pi with 5% fetal bovine serum for h at room temperature Tissue lysates containing equal AChE activity were loaded onto the precoated ELISA plate and incubated for...
- 12
- 488
- 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
Ngày tải lên :
19/02/2014, 16:20
... 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA TTTTCGTTAATTAACA-5¢ ... and auto-oxidation rates of Ec DOS PAS, and catalytic activities of full-length enzymes We found that the mutations at Asp40 markedly altered the redox potential and auto-oxidation rate Furthermore, ... ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 prior to spectroscopic measurements Titration experiments were repeated at least...
- 6
- 423
- 0
Excerpt from the Examination Regulations for the Master’s Program in Economics at the University of Mannheim docx
Ngày tải lên :
08/03/2014, 05:20
... obtained This statement will also contain the information that the candidate ultimately failed the master’s exam Closing provisions Invalidity of the master’s examination If the candidate cheats during ... of an ultimately failed master’s examination an official notification will be issued In case a candidate has ultimately failed the master’s examination he/she can request a written statement listing ... courses are subject to regulations that are in place at these departments Re-takes Each failed exam from the introductory phase has to be re-taken at the next possible date If the exam was an interim...
- 15
- 496
- 1
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... Met95 mutations, although the effects of the Leu99 and Leu115 mutations were modest compared with those of Met95 mutations It seems likely that potential data based on our data and that of others ... Taguchi S, Watanabe M, Matsui T, Sagami I & Shimizu T (2002) Characterization of a direct oxygen sensor heme protein from Escherichia coli Effects of the heme redox states and mutations at the heme-binding ... that of the wild-type enzyme We further found that the rates of auto-oxidation and the redox potentials were significantly changed by the mutations of these two residues It is interesting that...
- 14
- 390
- 0
Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc
Ngày tải lên :
17/03/2014, 10:20
... obtained in chlorate resistant mutants that not respire in the presence of nitrate, it is nitrate respiration, rather than nitrate per se, that abolishes nif expression [37,42] It appears that during ... centrifugation at 20 000 g for 30 and the fusion protein was purified from the supernatant by amylose affinity chromatography All purification steps were performed at °C in the dark, preventing degradation ... together, these data indicate strongly that under anaerobic conditions and at a favourable quinol/quinone ratio, the FAD-cofactor of NifL receives electrons from the reduced quinone pool generated by...
- 12
- 488
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
Ngày tải lên :
17/03/2014, 17:20
... propionate CoA-transferase from C propionicum was generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 ... glutamate 324 as the catalytic carboxylate of propionate CoA-transferase As the sequence analysis did not allow an unequivocal identi®cation of the catalytic glutamate of propionate CoAtransferase, ... CO2 + acetate± + propionate±, DG° )135 kJámol)1 acetate The enzymes involved are pyruvate:glutamate transaminase (1), glutamate dehydrogenase (2) (R)-lactate dehydrogenase (3), propionate CoA-transferase...
- 9
- 498
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
Ngày tải lên :
22/03/2014, 17:20
... Metcalf [31] demonstrated that primitive hematopoiesis starts with the formation of yolk sac blood islands in mouse embryos, and later studies by Medvinsky and Dzierzak indicated that the aorta– gonad–mesonephros ... cells of patients suffering Fig Schematic representation of hematopoietic development in the embryo The surface markers proving hematopoietic commitment at each stage of the differentiation process ... the earliest hematopoietic cells arising from hemato-endothelial commitment [57] Using this method, expression of hematopoietic transcription factors GATA-1 and GATA-2 was observed from days and...
- 12
- 550
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
Ngày tải lên :
23/03/2014, 15:21
... molecule that nucleates multiprotein signaling complexes Identification and cloning of LAT The first observation of the molecule that would later be named as LAT, was as a 36–38 kDa protein that was ... factors, NF -AT and AP-1 [18,22,26] Together, this indicates that the formation of multiprotein signaling complexes at LAT is crucial for linking LAT phosphorylation to the stimulation of intracellular ... have shown that the formation of LATmediated signaling complexes play a complex role in the differentiation and homeostasis of T-cell populations, the maturation of B cells and the activation of...
- 10
- 457
- 0
TEACHING WRITING USING PICTURE STORIES AS TOOLS AT THE HIGH SCHOOL LEVEL: THE MOVEMENT FROM OTHER REGULATION TO SELF REGULATION doc
Ngày tải lên :
24/03/2014, 19:20
... as Tools at the High School Level: The Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 42 writing tasks that lead students to pay attention to organization, while ... Tools at the High School Level: The Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 27 1.8 Scope of the Study The study attempts to teach writing in L2 at class ... Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 50 CHAPTER THREE REVIEW OF RELATED LITERATURE AND THEORETICAL FRAMEWORK 3.0 Introduction This chapter attempts...
- 261
- 641
- 1
Báo cáo khoa học: From functional genomics to systems biology Meeting report based on the presentations at the 3rd EMBL Biennial Symposium 2006 (Heidelberg, Germany) Sergii Ivakhno pot
Ngày tải lên :
30/03/2014, 09:20
... Microarray Innovations in Leukaemia (MILE, an international initiative with 11 centres from Europe, USA and Singapore), DNA microarrays are being used to analyze samples from more than 2000 patients ... Haferlach estimates that, once the AmpliChip is available, it will provide a more accurate, faster and costsaving strategy for diagnosis of leukaemia From systems to networks biology Talks related to ... provides a natural method for integration of different biological data Transcription regulatory networks I begin by describing talks that addressed analysis of transcription regulatory networks...
- 10
- 478
- 0
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx
Ngày tải lên :
30/03/2014, 20:20
... recombination from the states D+QA– or D+QA–QB, in addition to Q/RC The quinone release rate kout[D+QA)QB] can be normalized to the back electron transfer rate from the appropriate state; kout[D+QA)QB]/kAD[D+QA)QB], ... approximation holds because the direct recombination reaction from the D+QAQB– state has a negligible kinetic constant (kBD < 0.1 s)1) [28,29] In the presence of a subsaturating quinone concentration, ... observed [30] with a subsaturating quinone concentration in which the kS depends on the concentration of added quinone, ranging from 1.1 s)1 to 2.7 s)1, showing a fast exchange at the QB site Agostiano...
- 11
- 365
- 0
báo cáo sinh học:" Recent changes in human resources for health and health facilities at the district level in Indonesia: evidence from 3 districts in Java" doc
Ngày tải lên :
18/06/2014, 17:20
... (RSB)) Maternity clinic (Rumah Bersalin (RB)) Maternity clinic (Rumah Bersalin (RB)) Health center (Pusat Kesehatan Masyarakat (Puskesmas)) 0 15 19 62 62 Health center (Pusat Kesehatan Masyarakat ... center (Pusat Kesehatan Masyarakat (Puskesmas)) 51 51 Auxiliary health center (Puskesmas pembantu (Pustu)) 82 118 Treatment clinic (Balai pengobatan (BP)) Treatment clinic (Balai pengobatan (BP)) ... outcome of a national policy, are likely to be indicative of what happened across the nation They have important implications for the sector as a whole in terms of funding, decentralization, health...
- 6
- 432
- 7
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf
Ngày tải lên :
07/08/2014, 16:20
... concentrations at the limed treatments are still at an average level for German spruce trees [43] This fact indicates a well functioning relocation of P from older to younger needles The limed treatments ... No treatment eect could be observed during the whole investigation period Ca concentrations reached from low to high on the unlimed treatments and from average to very high on the limed treatments ... our data, and no reason is given for a translocation of Mg from older to younger needles Nearly all estimated elemental concentrations showed very high year to year variations, but low treatment...
- 9
- 286
- 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx
Ngày tải lên :
12/08/2014, 01:22
... preparations (PMP) were coated into 96-well plate (Costar, Lowell, MA) at concentration of 25 μg/ml overnight at 4°C Plates were rinsed with PBS and then blocked with 0.2% BSA in PBS for hours at ... added to wells and incubated at 4°C for one hour Wells not coated with plasma membranes but blocked and treated with virus as indicated above were used as negative controls Plates were then washed ... Senne DA, Suarez DL: Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control...
- 7
- 512
- 0
báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc
Ngày tải lên :
12/08/2014, 05:20
... and PRMM55 (5'-ggagtcgcatatgggatgcttttcatgctg-3'), PRMMH53 and T3 (5'-attaaccctcactaaag-3') and PRMMH85 (5'-ccgcgaggcattctgaaatcg-3') and PRMMH70 (5'-gtggtactagcaagcatgataa-3'), respectively ... (5'-tagggaggtcgacatgggatgcttttcatgctgc-3') and PRMMH66 (5'-ggagtcaggatccttcactgcagatttcgtccc-3') or PRMMH67 (5'tagggagggtaccatgggatgcttttcatgctgc-3') and PRMMH68 (5'ggagtcaagcttcttcactgcagatttcgtccc-3'), ... were generated by sitedirected mutagenesis using primer JK3 in combination with one of the following primers: D1 (5'-gagggatccatggcatgcttttcatgctgc-3'), D2 (5'-gagggatccatgggagccttttcatgctgc-3'),...
- 22
- 321
- 0