fredholm equations of the second kind on a contour

... Here, A is a product of fractions of the form ppsrd a for all a relatively prime to p Since d a the numerator and denominator of each of these fractions are units in Z/(ps ), all the fractions are ... papers, the dimension of the homology of the null chain is In that case, the character is (−1)r+1 times the M¨bius function The sign depends on this o The action of Sn on P induces a canonical action ... of a poset Q is concentrated in a single dimension r, then the character of the action of a group G o on the homology of Q is (−1)r times the M¨bius function of the poset Note that in many papers,...

Ngày tải lên: 07/08/2014, 06:20

... of the head was opened The articular cartilage of the second metatarsal head was found to be detached from the subchondral bone The damaged articular cartilage was removed, and a cylindrical ... the MTP joint of the right second toe show that the transplanted osteochondral graft was united well with the host bone of the second metatarsal head and that the articular surface of the graft ... Figure Magnetic resonance imaging (MRI) studies of the metatarsophalangeal joint of the right second toe (A) A low-intensity zone was detected within the second metatarsal head in the sagittal plane...

Ngày tải lên: 10/08/2014, 23:22

... The other popular causes are carelessness and idea organization The least common cause is generalization The cause of fossilization and overgeneralization: Fossilization and overgeneralization ... detailed classification, the features of fragments committed by the participants of the Academy are visible The main feature among all of them is the lack of some certain constituents such as ... Apart from the main causes of errors in second language learning above, there is another cause called overgeneralization This is simply the expansion of the foreign language patterns into areas...

Ngày tải lên: 28/03/2015, 09:12

... at resonance, J Math Anal Appl 294 (2004), 147-157 [10] X Zhang, M Feng, W Ge, Existence result of second- order differential equations with integral boundary conditions at resonance, J Math Anal ... several new ideas and gives a unified method of attack for many boundary value problems at resonance Previous paper dealt with one problem at a time whereas our method allows us to solve many ... important to on dom as well as the correspondent nonlinear boundary value problems at resonance by using the Mawhin’s continuation theorem (see [4, 8, 10, 11] and references therein) In the following...

Ngày tải lên: 14/10/2015, 08:45

... indicated that the RasGEF activity of v -KIND induces the phosphorylation of MAP2 by JNK1 and ⁄ or ERK via the activation of the Ras–Raf–MAP kinase pathway [12] These results appear to be in agreement ... signal transduction pathways [1,2] The kinase noncatalytic C-lobe domain (KIND) was determined to be a putative signaling domain based on bioinformatic analysis of the N-terminal sequence of the ... deletion of both KIND1 and KIND2 ; DRasN, deletion of RasN; DGEF, deletion of RasGEF; KIND1 , KIND1 domain; KIND2 , KIND2 domain (B) KIND2 domain anchors v -KIND to dendrites Flag-tagged v -KIND, DKIND1,...

Ngày tải lên: 14/02/2014, 19:20

... usually cartoon or animated characters – are normally owned by the companies that make the food and beverage products, and the characters are used on the packaging and in their advertising In contrast, ... accuracy of the information presented in this document However, readers are advised that errors of interpretation may have occurred and information available at the time of the research may be ... Gritschneder Y An analysis of the regulatory and voluntary landscape concerning the marketing and promotion of foods and drinks to children National Heart Forum London, 2011 23 The StanMark Project...

Ngày tải lên: 18/02/2014, 21:20

... observed rate can be attributed to formation of the Fe(III)–M80 axial bond, providing strong indication that the slow phase is coupled to formation of the native axial coordination The absorption spectra ... secondary structure in acid-denatured ferricytochrome c upon addition of increasing amounts of sulfate and selenate; the divalent anions stabilize the A- state at significantly lower concentrations ... sulfate Absorption spectra in the visible range are a 10-fold magnification of original spectra (D) Absorption spectra of the aciddenatured K13N mutant (spectrum a) , of the K13N mutant after ms of...

Ngày tải lên: 19/02/2014, 05:20

... Watt Department of Computer Science The University of Western Ontario London Ontario, Canada N 6A 5B7 {coancea,watt}@csd.uwo.ca Abstract libraries are made available as components in a multi-language, ... domains can be used in applications with aspects that cross multiple domains For example, a Java application that stores data in a relational database, processes the data and displays it using a ... error handling In a stand-alone application, the code that detects an exceptional situation often also directly handles it in the way that is appropriate for the particular application In a library...

Ngày tải lên: 14/03/2014, 11:20

... into the process as well Regional organizations and institutions can help facilitate cooperation and coordination and international financial institutions and donors can then play a vital role ... Equatorial Guinea, the Intergovernmental Agency of the Francophonie (AIF), the City of Dakar, the City of Geneva, the City of Delémont (Switzerland), the City of Lyon, the City of Paris, the City of ... Arab countries (Kuwait, Saudi Arabia and United Arab Emirates) and other donors (Israel and others) China and India also provide aid, but the numbers are not yet reported internationally 45 The...

Ngày tải lên: 15/03/2014, 19:20

... pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC ... McClean, VA, USA) The attenuance of formazan formed in control cells was considered as 100% viability Statistical analysis Data are expressed as the mean ± SEM of the indicated number of separate experiments ... activation [18] and mitochondrial depolarization [19], blocks apoptosome formation and activation of caspase-9 [20], and inhibits the release of apoptosisinducing factor (AIF) from mitochondria...

Ngày tải lên: 16/03/2014, 01:20

... procedure according to a protocol from the manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC ... CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases Papain (EC 3.4.22.2) was purified, ... because of the instability of the enzyme at the low concentrations and the long reaction times that would have been necessary Therefore, Kd for the interaction with papain was calculated as kdiss/kass...

Ngày tải lên: 17/03/2014, 10:20

... GluR -A and AMPA receptor mediated synaptic currents [16] SAP97 may also play a role in the endocytosis of GluR -A AMPA receptors, based on identification of a ternary complex between SAP97, GluR -A and ... b-strands (bA to bF) and two a- helices (aA and aB) (Fig 4) The structure of the C378G variant of SAP97PDZ2 was practically identical to that of C378S variant, except for the mutated residue, and ... crystallographic analysis shows a canonical class I interaction between SAP97PDZ2 and GluR -A1 8 peptide The discrepancy between the relative scarcity of interactions in the complex structure and the...

Ngày tải lên: 30/03/2014, 10:20

... as calculated by the reviewers (mean of word recognition and word attack measures; also mean of comprehension measures, mean of spelling measures, and synthetic versus analytic, where applicable), ... hours.   Table 3: Details of instructional time and of instruction received by the intervention groups, cont Author, date Information about what other literacy instruction participants were receiving, ...  Table 2: Quality assessment of the included RCTs Author, date Reporting of method of allocation  Sample size justification  Intention to teach analysis  Blinded assessment of outcome...

Ngày tải lên: 02/06/2014, 09:22

... and analysis and participated in the interpretation of the data and discussion of the findings AS advised on the study design and analysis and participated in the interpretation of the data and ... interpretation of data, and drafting the manuscript JIR participated in a conception and designing of the study, analysis and interpretation of the data, and drafting the manuscript GT advised on the ... with the participants about the questionnaire Minor modifications were made to the format of questionnaires and to the wording Secondly, the backward translation of the draft version of the Korean...

Ngày tải lên: 18/06/2014, 22:20

... points of a rhombus draw a straight line parallel to a diagonal, and let a system of conic sections be drawn, each touching the parallel to the diagonal, and also passing through the three remaining ... plane are always inclined at the same angle, the intersection of such planes will trace out another cone of the second order having a cyclic plane in common with the first cone” The analytical proof ... vertex and axis, and be such that sections made by a plane perpendicular to the axis, all have the same major axis, the sum or difference of the angles which any side of one of the cones of the system...

Ngày tải lên: 28/06/2014, 19:20

... increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder  As the cylinder spacing increases, the wave force on the cylinders not decrease linear to the wave ... force on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio   0.2  Due to the interaction of ... xạ(Diffraction phenomenon)  As an incident wave impinges on the cylinder, a reflected wave moves outward On the sheltered side of the cylinder there will be a “shadow” zone where the wave fronts are...

Ngày tải lên: 26/07/2014, 07:20

... Acknowledgments The author thanks Herbert Wilf and Janet Beissinger, who was the first to explore [1] combinatorial proofs using colored permutations, for their assistance References [1] Janet Beissinger ... Colorful proofs of generating function identities Unpublished notes, 1981 [2] Richard P Stanley Enumerative combinatorics Vol 1, volume 49 of Cambridge Studies in Advanced Mathematics Cambridge ... Sn ,A , let R(π,f ) = {(i, j) : i < j n; f (Kπ (i)) = f (Kπ (j))} be the set of pairs of distinct elements of [n] in cycles–not necessarily distinct–colored the same way by f Define a map φ on...

Ngày tải lên: 08/08/2014, 01:20

... for Quality in Health Care [20], Accreditation Canada is a national, non-profit, independent organization that was created in 1958 to help guarantee that healthcare organizations across Canada furnish ... transformation, organizational transformation and transformation of the relationship) Insofar as internal and external conditions are concerned, four factors are seen to promote change: (1) an ... representatives of various departments and followed the recommendations of Accreditation Canada After accreditation in 2003, the CEO went a step further and integrated Accreditation Canada's quality...

Ngày tải lên: 10/08/2014, 10:22

... phrases organizational transformation and transformational changes For example, King defined organizational transformation as, 'a planned change designed to significantly improve overall organizational ... by the authors as recurrent themes based on a regular attention to health management publications, and through discussions with members of the Southeast Texas Chapter of the American College of ... publications Data abstraction Both authors reviewed the included studies and arrived at a consensus on the abstracted information Setting included type of health service organization and if the article...

Ngày tải lên: 11/08/2014, 05:21

... phrases organizational transformation and transformational changes For example, King defined organizational transformation as, 'a planned change designed to significantly improve overall organizational ... by the authors as recurrent themes based on a regular attention to health management publications, and through discussions with members of the Southeast Texas Chapter of the American College of ... publications Data abstraction Both authors reviewed the included studies and arrived at a consensus on the abstracted information Setting included type of health service organization and if the article...

Ngày tải lên: 11/08/2014, 16:20