four pivotal studies of treatment of chronic hepatitis c in hiv infected persons
Báo cáo y học: "Clinical Profiles of Chronic Hepatitis C in a Major County Medical Center Outpatient Setting in United States" pptx
Ngày tải lên :
08/08/2014, 18:20
... Patients were consecutively collected from the Hepatitis Clinic at Los Angeles County-USC Medical Center between January 1990 and December 1998 The inclusion criteria included: chronic HCV infection ... followed in the Hepatitis Clinic at USC-LAC Medical Center In these patients, 71.4% were minorities, including African American, Hispanic, and Asian patients, indicating that a high prevalence of HCV ... hepatitis clinic To verify the accuracy of clinical discriminant score in diagnosing cirrhosis, the clinical diagnosis was further assessed in 79 patients who had pathological diagnosis Compared...
- 9
- 388
- 0
longterm outcome of chronic hepatitis b in causasian pts - mortality after 25 years 2008
Ngày tải lên :
13/08/2014, 09:45
... history of chronic hepatitis B The complex viral interplay in cases of dual or triple infection28 may provide an explanation to the clinical evidence in longitudinal studies that HBV/HDV coinfection ... upper normal value during follow-up and remained untreated Clinical outcome of inactive carriers The clinical outcome of the 40 inactive carriers during a median follow-up period of 23 years (range, ... long life expectancy Our data suggest that recent findings from cohort studies in Chinese subjects in their 40s with perinatally or early childhood acquired HBV infection (85% of cohort HBeAg...
- 8
- 374
- 0
Báo cáo y học: "Role of the eosinophil count in discriminating the severity of community-acquired pneumonia in HIV-infected patients" pps
Ngày tải lên :
13/08/2014, 11:22
... Med Interne 2003, 24:431-435 Bass DA, Gonwa TA, Szejda P, Cousart MS, DeChatelet LR, McCall CE: Eosinopenia of acute infection: production of eosinopenia by chemotactic factors of acute inflammation ... rate among HIV- infected patients suffering from CAP This finding was also reported in our work involving a diverse group of critically ill adults admitted to the ICU The lack of differences between ... marker of sepsis on admission to medical intensive care units Crit Care 2008, 12: R59 Francis RC, Spies CD, Kerner T: Quality management and benchmarking in emergency medicine Curr Opin Anaesthesiol...
- 2
- 207
- 0
Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf
Ngày tải lên :
12/08/2014, 01:21
... systematic review of these trials to assess the evidence obtained on the efficacy of LdT treatment in chronic HBV infection Page of 11 decompensated liver disease, HIV, hepatocellular carcinoma, prior ... been introduced to lots of low-income economy countries like China So lamivudine and telbivudine are more widely used in treatment of CHB In this systematic review, we focus on the comparison of ... recently, some randomized controlled clinical trials compared the efficacy of LAM and LdT in the treatment of chronic hepatitis B and had different results Thus, we conducted this systematic...
- 11
- 398
- 0
Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."
Ngày tải lên :
02/11/2012, 09:48
... ribavirin for chronic hepatitis C virus infection in HIV- infected patients N Engl J Med 2004;351(5):438-450 16 Graham CS, Baden LR, Yu E Influence of human immunodeficiency virus infection on the course ... if this criteria is not met [15] Cirrhotics Treatment of non-decompensated cirrhotics is important since they have reduced survival, increased incidence of HCC and progression to a decompensated ... al The effect of long term and high dose interferon treatment in chronic hepatitis C Pathol Oncol Res 1996;291: 59-62 31 Kaiser S et al Successful retreatment of chronic hepatitis C patients...
- 6
- 389
- 0
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
Ngày tải lên :
03/11/2012, 09:41
... practical clinical approach to management of CHB Clinical Presentation of Chronic HBV Infection As discussed by Drs Zhang and Pan in this special issue, the clinical presentation of chronic HBV ... HBV infection can be quite different ranging from inactive carrier status to HBV-cirrhosis or hepatocellular carcinoma (HCC) Understanding the spectrum and clinical presentation of chronic HBV infection ... and could induce hepatic decompensation, and therefore relatively contraindicated in this group of patients The value of combination HBV treatment remains to be determined Results on efficacy of...
- 7
- 541
- 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot
Ngày tải lên :
30/03/2014, 03:20
... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc myc myc N6 (CCG414 fi TAA, Pro25 fi stop in core ORF) Deletion of core nts 342–514 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG...
- 18
- 365
- 0
báo cáo hóa học:" The pivotal role of the intermediate fragment in initial operative treatment of olecranon fractures" pdf
Ngày tải lên :
20/06/2014, 04:20
... screw secures reduction of fracture fragments including alignment of the intermediate fragment to the trochlear face In the operative report precise description of the fracture pattern including ... well-established classifications of olecranon fractures e.g Mayo and Schatzker-Schmeling classification Mayo classification type II and III and Schatzker-Schmeling classification type B and D describe an intermediate ... PM, Küchle R, Schneider RU, Reuter M: Olecranon fractures in adults: factors influencing outcome Injury 2004, 35(11):1149-1157 Morrey BF: Current concepts in the treatment of fractures of the...
- 9
- 317
- 0
báo cáo hóa học:" The pivotal role of the intermediate fragment in initial operative treatment of olecranon fractures" doc
Ngày tải lên :
20/06/2014, 07:20
... screw secures reduction of fracture fragments including alignment of the intermediate fragment to the trochlear face In the operative report precise description of the fracture pattern including ... well-established classifications of olecranon fractures e.g Mayo and Schatzker-Schmeling classification Mayo classification type II and III and Schatzker-Schmeling classification type B and D describe an intermediate ... PM, Küchle R, Schneider RU, Reuter M: Olecranon fractures in adults: factors influencing outcome Injury 2004, 35(11):1149-1157 Morrey BF: Current concepts in the treatment of fractures of the...
- 9
- 302
- 0
Báo cáo y học: "Role of anti-cyclic citrullinated peptide antibodies in discriminating patients with rheumatoid arthritis from patients with chronic hepatitis C infection-associated polyarticular involvement" potx
Ngày tải lên :
09/08/2014, 01:23
... diagnostic tool because a high percentage of patients with chronic HCV infection display serum RF reactivity, and the frequency of RF increases in patients with articular involvement [4,5] which the ... anti-CCP reactivity In contrast, we confirmed the increased sensitivity of the anti-CCP2 test with a prevalence of 76.6% in our patients with RA, comparable with that obtained in recent studies ... in cases of HCV-related arthropathy, RF detection is not very useful because it is often observed in sera of patients with HCV In particular, classic IgM RF can be detected in more than 60% of...
- 5
- 312
- 0
Báo cáo y học: " Reliability and predictive validity of a hepatitisrelated symptom inventory in HIV-infected individuals referred for Hepatitis C treatment." docx
Ngày tải lên :
10/08/2014, 05:22
... Pegylated interferon alpha-2b plus ribavirin for the treatment of chronic hepatitis C in HIV- coinfected patients J Infect 2006, 53:36-42 Butt AA, McGinnis KA, Skanderson M, Justice AC: Hepatitis C treatment ... HCV treatment initiation Clinical HCV treatment initiation decisions were made following multidisciplinary review of medical, psychiatric, social and substance abuse assessments Psychiatric care ... 24 of chronic hepatitis B and C in HIV co -infected patients J Hepatol 2005, 42:615-24 Butt AA, Justice AC, Skanderson M, Good C, Kwoh CK: Rates and predictors of hepatitis C virus treatment in...
- 9
- 483
- 0
Báo cáo y học: " Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis B to interferon alfa" ppt
Ngày tải lên :
11/08/2014, 21:21
... tac ctg act agc 3’ 5’ tca ttc tat gtg ctg gag atg g 3’ 5’ tgg ggg aag tgg gta aga gt 3’ 5’ ctc gct gca acc caa ctg gc 3’ 5’ ctc gct gca acc caa ctg gc 3’ 419 419 139 Rsa Mae III Mnl Cuts the ... prevalence due to hepatitis B vaccination Vaccine 2009, 27:6550-6557 Kew MC: Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B virus-induced hepatocellular ... A: Genetic influence on cytokine production in meningococcal disease Lancet 1997, 349:1912-1913 Constantini PK, Wawrzynowicz-Syczewska M, Clare M, Boron-Kaczmarska A, McFarlane IG, Cramp ME,...
- 6
- 290
- 0
Báo cáo y học: "Serological and molecular expression of Hepatitis B infection in patients with chronic Hepatitis C from Tunisia, North Africa" pdf
Ngày tải lên :
12/08/2014, 01:21
... Scolastico C, Filippini P, Santantonio T, Stroffolini T, Piccinino F: Virologic and clinical expressions of reciprocal inhibitory effect of hepatitis B, C, and delta viruses in patients with chronic ... virus and hepatitis C virus coinfection Ann Clin Microbiol Antimicrob 2005, 4:13 31 Sagnelli E, Coppola N, Marrocco C, Onofrio M, Sagnelli C, Coviello G, Scolastico C, Filippini P: Hepatitis C virus ... the type of interaction may depend on the chronology of contamination with the two viruses: HCV superinfection in previously HBV infected patients, co-infection or HBV infection in HCV positives...
- 6
- 516
- 0
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx
Ngày tải lên :
12/08/2014, 02:20
... volume of 50 mL (forward primer, 5’-CTGCCTGGCAGAAAACTTACC-3’; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase ... be involved in IFN-mediated antiviral activity against HCV, are expressed in PBMCs Table Baseline and IFN-induced expression of microRNAs and MxA-mRNA in patients with chronic hepatitis C according ... Medicine, Laboratory of Virology, “Sapienza” University of Rome; Rome, Italy 2Department of Medicine and Science of Aging, Infectious Disease Clinic, G d’Annunzio University, School of Medicine,...
- 9
- 336
- 0
Báo cáo y học: "Keratin 18 phosphorylation as a progression marker of chronic hepatitis B" pot
Ngày tải lên :
12/08/2014, 04:20
... hepatitis caused by HCV, suggesting a role of FAS-mediated hepatocytic apoptosis in eliminating infected cells [24] In the case of primary hepatocellular carcinoma (HCC), integration of the X ... viral infection that results in inappropriate or ineffective induction of cytotoxic T lymphocytes (CTLs) and production of cytokines They may lead to continued viral replication, non-specific inflammatory ... hepatic inclusion bodies observed in diverse chronic liver diseases such as alcoholic and non-alcoholic steatohepatitis, chronic cholestasis, metabolic disorders and hepatocellular neoplasms, are composed...
- 8
- 273
- 0
a large scale, multicentre, double-blind trial of ursodeoxycholic acid in pts with chronic hepatitis c 2007
Ngày tải lên :
13/08/2014, 09:44
... each institution participating in the study Patients were informed of the details of the clinical study and agreed to participate We conducted this clinical study in accordance with the Declaration ... act on the biliary system in CH -C through enhanced bile formation and/or modification of bile acid composition In fact, bile duct injury is characteristic of CH -C, although not specific.23 In ... preferable in patients with prevailing biliary injuries hronic hepatitis C (CH -C) is a common liver disease worldwide The prevalence of hepatitis C virus (HCV) infection increased recently in several countries1...
- 8
- 406
- 0
Báo cáo y học: "Overview of the diagnostic value of biochemical markers of liver fibrosis (FibroTest, HCV FibroSure) and necrosis (ActiTest) in patients with chronic hepatitis C" doc
Ngày tải lên :
13/08/2014, 13:20
... number of patients with chronic hepatitis C, and the results were reproducible in different populations, including patients coinfected with HIV There was a small variability in the AUROCs, Page of ... (FibroTest) and necrosis (ActiTest) can be recommended as an alternative to liver biopsy for the first line assessment of liver injury in patients with chronic hepatitis C In clinical practice, liver ... diagnostic values with other biochemical markers In four studies there was a direct comparison in the same patients of FT versus other biochemical markers, including hyaluronic acid [12], the Forns index...
- 12
- 214
- 0
Báo cáo y học: "The effectiveness of ENAR® for the treatment of chronic neck pain in Australian adults: a preliminary single-blind, randomised controlled trial" potx
Ngày tải lên :
13/08/2014, 14:20
... device combines Western electrical biofeedback with Eastern energy medicine This preliminary study investigated the response of people with non-complicated chronic neck pain (NCCNP) to two treatments ... any perception of a treatment either occurring or not Each of the groups received 10 minutes of their respective therapy, including the control group according to the schedule outlined in Additional ... allocated cohort (n = 24) of chronic neck pain sufferers, including neck pain intensity, neck function, disability and its overall influence on quality of life Methods A randomised, controlled single-blinded...
- 11
- 271
- 0
The clinical research of the therapy zhengxuxielian combined with interferon for treating chronic hepatitis c
Ngày tải lên :
13/05/2016, 16:39
... observe the clinical effects of the Chinese herb (The Clinical Research of the Therapy Zhengxuxielian combined with interferon for Treating Chronic Hepatitis C) in treating chronic hepatitis C. It is ... combined with interferon for chronic hepatitis C positive imaginary evil love card in clinical studies to obtain better curative effect, mainly reflected in the improvement of clinical symptoms ... vii Abstract Abstract Hepatitis C virus is an infectious disease caused by hepatitis C virus infection.The incidence of hepatitis C range, high, harmfulness of it, in a variety of infectious diseases,...
- 115
- 103
- 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
Ngày tải lên :
17/02/2014, 22:20
... agricultural insecticide by disturbing activity of acetylcoline-esterase.106) It is classified as “Moderately hazardous (class II) technical grade active ingredients in pesticides continued” by IPCS.107) ... public health since 1970 by the “Act for Maintenance of Sanitation in Buildings”; however, small buildings and individual residences are not included, and the substances in indoor air and their concentrations ... solvent and in printing ink.80) Para-dichlorobenzene, 1,4-dichlorobenzene, is an organic compound with the chemical formula C6 H4 Cl2 , forms colorless to white crystals with a characteristic odor,...
- 14
- 940
- 1