forming the natural logarithm of a floating point number
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
Ngày tải lên :
22/03/2014, 10:20
... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting ... lipoprotein; M, male The AST/ALT ratio was greater than in 29% of children GGT was elevated in 88% of patients while serum alkaline phosphatase was above the normal value for age and sex in few patients...
- 7
- 487
- 0
Báo cáo toán học: "A natural series for the natural logarithm" pot
Ngày tải lên :
07/08/2014, 15:23
... yields the result A power series for the natural logarithm Here we study an application of Equation (1) which leads to an interesting identity For the polynomial + a the right-hand side of Equation ... j j k2 √ a+ √ a 2j 2j j On the other hand we know by Theorem 1.1 that the right-hand side of Equation (1) equals the logarithm of the Mahler measure of (1 + a) which is This shows: Theorem 2.1 ... For a square matrix M with entries in CG the trace trCG (M ) denotes the coefficient of the unit element in the sum of the diagonal elements The matrix A = (¯j,i ) is the conjugate transpose of a...
- 7
- 244
- 0
Báo cáo y học: " The natural history of West Nile virus infection presenting with West Nile virus meningoencephalitis in a man with a prolonged illness: a case report" doc
Ngày tải lên :
11/08/2014, 00:23
... positive (acute and convalescent phase) A brain MRI scan (Figure 1C) obtained on day 21 revealed resolving inflammatory changes in the basal ganglia and thalamus Six weeks later he was fully oriented ... the patient data regarding the clinical presentation and were major contributors in writing the manuscript JW performed and interpreted the MRI data MCL reviewed all of the data and made major ... of the disease In our patient, we found that the brain MRI findings (bilateral edema and hyperintensity of the basal ganglia and thalami) were helpful in this clinical setting to establish a preliminary...
- 4
- 310
- 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps
Ngày tải lên :
11/08/2014, 08:22
... site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse ... Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an antiinflammatory ... Withania somnifera (ashwagandha): a review Altern Med Rev 2000, 5:334-346 Bargagna-Mohan P, Ravindranath PP, Mohan R: Small molecule anti-angiogenic probes of the ubiquitin proteasome pathway:...
- 5
- 306
- 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps
Ngày tải lên :
13/08/2014, 01:20
... 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using primer 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated ... using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, 4) the mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R ... prototype FeLV -A isolates FeLV -A/ 61E [GenBank:AAA93093], FeLV -A/ 3281 [GenBank:AAA43051] and FeLV -A/ Glasgow [GenBank:AAA43053], from FeLV-945 [GenBank:AAT76450] and from other representatives of the cohort...
- 17
- 267
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
... for the grading and staging of chronic hepatitis C The activity of liver disease or grade, is gauged by the number of mononuclear inflammatory cells present in and around the portal areas, and ... individuals The most widely quoted data on the prevalence of HCV in the United States comes from the third National Health and Nutrition Examination Survey (NHANES), a national survey of a representative ... users, the prevalence of chronic HCV infection in African American men was 95%.[24, 25] The NHANES study also revealed a higher rate of chronic infection among African Americans (86%), compared...
- 6
- 530
- 0
THE NATURAL HISTORY OF MORALS
Ngày tải lên :
22/10/2013, 13:20
... deliverance from a weight becoming unendurable, is the appearance of an absolute ruler for these gregarious Europeans of this fact the effect of the appearance of Napoleon was the last great proof the ... level of the ‘man of the future’—as idealized by the socialistic fools and shallow-pates—this degeneracy and dwarfing of man to an absolutely gregarious animal (or as they call it, to a man of ‘free ... perspective, here again fear is the mother of morals It is by the loftiest and strongest instincts, when they break out passionately and carry the individual far above and beyond the average, and the low...
- 33
- 446
- 0
The Natural Functions of Secondary Metabolites
Ngày tải lên :
26/10/2013, 02:20
... form of Claviceps on the seed heads of grasses and cereals has led to widespread and fatal poisoning ever since the Middle Ages [33] Natural soil and wheat-straw contain patulin [34] and aflatoxin ... Phaffia rhodozyma, protects the organism against killing by singlet oxygen [251] and provides a selective advantage against albino mutants The natural habitat of the yeast is sap flux of the birch ... of actinomycetes are chromosomal (the usual situation), they are clustered, which facilitates transfer of an entire pathway in a single manipulation The genes of the actinorhodin pathway, normally...
- 39
- 605
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu THE Natural HISTORY OF CHOCOLATE docx
Ngày tải lên :
13/02/2014, 12:20
... chiefly at Mexico, in the Provinces of Nicaragua and Guatimala, as also along the Banks of the River of the Amazons (n) Likewise upon the Coast of Caraqua, that is to say, from Comana to Cartagena ... divided and separated by the Agitation of the Mill, and so entangled in the Chocolate, that there will be no danger of a future Separation Besides, the aromatick Particles of the Cinnamon, and the alkaline ... when they would make the Cassave, they spread the sifted Manioc upon a Plate of Iron over a clear Fire, which they tapping down with the Ball of their Hands, make a broad Cake about half an Inch...
- 54
- 547
- 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... free radicals at the surface of the epidermis Biochem Biophys Res Commun 136, 630–637 16 Nakamura, H., Matsuda, M., Furuke, K., Kitaoka, Y., Iwata, S., Toda, K., Inamoto, T., Yamaoka, Y., Ozawa,...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
