for how big can a dlci be
Tài liệu CCNA Exam Certification Guide ppt
Ngày tải lên :
17/01/2014, 08:20
... these courses probably exceeds what is required for CCNA; however, a disadvantage of being a typically younger candidate is that you may not have learned as much information “accidentally,” by simply ... set of bits called a packet (Step 3) The appropriate datalink header and trailer are wrapped around the packet, creating a frame (Step 4) Finally, the physical layer applies appropriate energy ... Wednesday, February 17, 1999 2:39 PM Analysis of CCNA Training Paths 11 Table 1-1 summarizes the training paths for CCNA certification Table 1-1 CCNA Training Path Training Path What Is Involved CCNA...
- 638
- 6.4K
- 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc
Ngày tải lên :
16/03/2014, 06:20
... separate individual domains: D1, MfeI and XhoI; D2, XhoI and AatII; D3, AatII and AvrII PCR using Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and ... CTA QuikChange mutagenic primers D1 forward CAT CCA CAC D1 reverse CCT AAG TTA D2 forward CGT GCT GAC D2 reverse CCC AGG TTG D3 forward CAT CCT GAC D3 reverse CCC AGG TTG AAT AGT GAA CAG ACG GGC ... 9.1ab 5. 1a 14. 0a 1.1ab 7. 6a 11. 6a 0. 1a ± ± ± ± ± ± ± ± 34.9 19.8ab 11. 1a 30. 4a 2.4ab 16. 5a 24. 9a 0. 2a a Values that are significantly different from wild-type (P < 0.05) Mutants that are significantly...
- 9
- 567
- 0
THE ROLE OF THE FINANCIAL SERVICES SECTOR IN EXPANDING ECONOMIC OPPORTUNITY potx
Ngày tải lên :
29/03/2014, 08:20
... Management and Research) Gary Hattem (Deutsche Bank Foundation); Roberta Mokrejs Paro (Fundação Dom Cabral) Linda Murasawa (Banco ABN AMRO Real) Robert Osei (University of Ghana) Adam Popat (Standard ... collectors already exist.55 Challenges Ghanaians have traditionally viewed Barclays as a bank for the elite As a result, Barclays has had to work to gain trust, largely through its training efforts and ... availability and affordability of banking and savings accounts The major banking players have already gained significant traction in this area by increasing the number of branches, ATMs, and other...
- 48
- 837
- 0
Effects of the three obediences and four virtues ethics on vietnamese women in the present time
Ngày tải lên :
19/08/2015, 09:33
... composing and painting abilities 8 Good appearance: A woman must be affable, neat and respects her outward appearance Well-spoken: Spoken words must be gentle and deliberate Well-behaved: At home, ... Confucianism, Culture and Information Publisher, Hanoi; Quang Dam (1994),Confucianismin the past and nowadays, Literature Publisher, Hanoi; Tran Van Giau (1985),Traditional spiritual Value in Vietnam, ... her father On the other hand, in a marriage, wife is always dependent on her husband Today, although the Law proposes the monogamous marriage, actually in many areas (some locals nearby Hanoi)...
- 29
- 910
- 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
Ngày tải lên :
25/10/2012, 10:45
... medical staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients Utilization of a MET system has been associated with a reduction in all-cause hospital mortality ... and a detailed log of all calls is maintained Criteria for medical emergency team activation Calling criteria for our MET service are based on acute changes in heart rate (130 beats/min), ... drugs and defibrillators Outcome measures Information on the activation of all MET calls is maintained on a hospital switchboard logbook that includes the date and time of the call, as well as the...
- 4
- 541
- 0
Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"
Ngày tải lên :
31/10/2012, 17:03
... interaction between PPARδ +294T/C and Apolipoprotein E (ApoE) was analysed for each ApoE genotype separately but did not present statistically significant results (data not shown) HDL plasma levels ... questionnaire and each case was validated by cardiac ultrasound and/or electrocardiographic examinations or by coronary angiography Table 1: Patient characteristics n Age (years) BMI (kg/m²) Cholesterol ... Genotyping DNA was extracted from white blood cells using standard methods A mutagenically separated polymerase chain reaction (MS-PCR) was developed to separate wildtype (wt) and mutated alleles as described...
- 4
- 568
- 0
Báo cáo y học: "Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects"
Ngày tải lên :
03/11/2012, 09:49
... distribution, and such data were analysed statistically Statistical analysis of the data analysis was carried out using the ANOVA test Prevalence of alleles and genotype among cases and control ... Lab auto-analyzer Plasma tHcy was determined by immunoassay (Abbott Laboratories, North Chicago, IL, U.S .A. ) Plasma folate levels were measured by radioimmunoassay using a commercial kit (Dualcount ... into an EDTA containing tube A separated aliquot was kept for DNA extraction Plasma samples were obtained by double centrifugation at room temperature for 15 minutes at 2000g The plasma aliquots...
- 12
- 519
- 0
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines
Ngày tải lên :
07/11/2012, 14:54
... Germany Fly Euro Shuttle! Air Canada Defy obstacles Air Canada Canada World class, worldwide Air France France Air France One of the best places on earth AIR INDIA India New Zealand your place ... Zealand - No ordinary airline - Virgin Atlantic Airways - Lufthansa There’s no better way to fly - Lufthansa - Table 2: Slogan language at lexical level The table shows a great number of slogans ... International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas The Spirit of Australia 39 Singapore Airlines Singapore Singapore Girl, you're a great way to fly The USA JetBlue You'll Want to Fly Again!...
- 45
- 1.4K
- 10
REVIEW OF THE FISHERIES SUPPLY CHAIN IN VIET NAM
Ngày tải lên :
28/03/2013, 13:51
... middle traders operates properly and regularly, the markets for the products will be stable and the vessel owners and fishers can also operate stably and regularly, creating the benefit balance between ... traders have not upgraded to become trading companies or enterprises although they have wide geographical areas for doiing bussiness (more partners) and big amount of capitals The reasons may be ... the VINAFIS has not exploited all their advantages, functions and roles If VINAFIS have enough human and financial resources, the VINAFIS will become a strong organization and can protect benefits...
- 46
- 562
- 0
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
Ngày tải lên :
23/04/2013, 10:29
... strategic management Hill and Jones (1998) say a company has a competitive advantage when its profit rate is higher than the average for its industry and it can sustain this advantage to maintain high ... calculate material and accessories required for each product and for the whole order and produce material balance Technical Department will make two standard samples for each order for approval ... elegant, fashionable and comfortable clothes For rural customers, price, quality and usage are more important Therefore, company can launch premium products in urban area and low cost and pragmatic...
- 75
- 920
- 4
Negotiating agrarian change livelihood agriculations of the commercial craft peasantry in northern vietnam
Ngày tải lên :
04/08/2013, 09:59
... mentioned above 7 1.2.1 The Category of the Peasant in Agrarian Theories According to Marxism, agrarian transitions equate to capitalist transformations Classical theories of agrarian change assert ... squeezed, and land, as well as crop productivity, has reduced significantly due to labor shortages In addition, large areas of farmland in Thailand, Malaysia and Bangladesh, have become idle or been ... being a craftsman makes him or her wealthier By becoming a craft-peasant, a villager can maintain the traditional ideologies of the farm-based economy and of trade dignification, or as the saying...
- 347
- 483
- 0
Simulation of the thermal borehole resistance in groundwater filled borehole heat exchanger using CFD technique
Ngày tải lên :
05/09/2013, 14:58
... (cq"pw) The comparison was performed for average temperature values at the pipe and borehole wall as well as water thermal resistance It was shown that for total heat transfer calculations (THT), ... legs acting as heat sources The heat transfer becomes radial after a distance out in the bedrock (rradial) This un-radial heat flow in the water changes the heat transfer compared to using an equivalent ... differ at all The Equivalent radius model is thereby also an appropriate approximation for CHT calculations, which has been shown earlier in several published papers for boundary condition constant...
- 12
- 371
- 0
The conservatism of the early English colonists in North
Ngày tải lên :
28/10/2013, 02:15
... 3 The relationship of a mortise and a tenon is most similar to that of (A) (B) (C) (D) a lock and a key a book and its cover a cup and a saucer a hammer and a nail For what purpose did ... Richard Morris Hunt, the first American architect to graduate from the Ecole des Beaux Arts in Paris Each man had lived in Paris, and each understood the economics and social potential of this Parisian ... could accommodate a variety of interior designs 40 The author mentions the Dakota and the Ansonia in line 24 because 37 It can be inferred that a New York apartment building in the 1870’s and 1880’s...
- 12
- 1.6K
- 7
A contrastive study of connotation of the vietnamese zodiac animals in english and vietnamese idioms and proverbs
Ngày tải lên :
26/11/2013, 13:29
... literal translation When there is no equivalent in target language or when idiomatic language seems inappropriate in target text, idioms and proverbs may be translated by paraphrase As it can be observed, ... the BEHAVIOR and PEOPLE ARE ANIMALS Moreover, many additional reference source that may be helpful in their teaching similes are used to compare with human’s appearance, character, emotions, state, ... charts As a result, connotations of VZAs in English and other authors and evidence from the data analysis Vietnamese idioms and proverbs have been described clearly, carefully and systematically...
- 13
- 1.1K
- 4
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese
Ngày tải lên :
26/11/2013, 13:30
... “young eagle”, “as big as an eagle” b Movement: “follow like an eagle” 4.1.1.8 Crow a Appearance: “crow’s feet”, “crow’s beak”, “as hoarse as a crow”, “as black as crow” b Colour: “as black as crow” ... translation contrastive and comparative analysis of the language matter can be 5.2 IMPLICATIONS FOR TEACHING, LEARNING AND recommended Method of this kind will make it easy for teachers to TRANSLATION ... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic...
- 13
- 1.7K
- 5
Tài liệu Final Report "Evaluation of time management skill of the 3rd year students in FFL - HUT" pptx
Ngày tải lên :
13/12/2013, 12:15
... content analysis, checking as well as rearranging data appropriately was done after the researcher had read and analyzed existing material from already-selected sources to get necessary information ... tips for managing time are recommended are available and prove really useful to students As a student, there are some basic Principles of Time Management that one can apply Identify "Best Time" for ... program Each of them completed one copy of the questionnaire After collecting necessary information, the researcher analyzed and evaluated the result, plotted information in diagram and explained...
- 11
- 687
- 1
An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre
Ngày tải lên :
18/12/2013, 10:08
... that give learners a chance for rehearsal – practising the real skill of speaking as a preparation for using it outside the classroom Speaking activities can be used at any stage of teaching Pair ... approach to language teaching The integrated approach to language teaching in general and reading comprehension teaching in particular has many advantages over the approach to teaching language skills ... language such as vocabulary, grammar and so on Motivation plays a crucial role in students' learning It can make learner's learning become better or worse In fact, using the integrated approach...
- 90
- 576
- 1
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... decay and an untimely grave, whose sad fate has been blazoned forth to point a moral or adorn a tale The men also who engage in that contest belong to a class who, from their position, may reasonably ... health A careful analysis of these cases seems to me to shew that if harm really was done by too great a strain being laid upon the system in early life, that harm may generally be accounted for ... was always thought that the part he took in the race injured a small vessel at the heart: previous to that he had been a particularly strong muscular man Eleven years after the Boat-Race he was...
- 419
- 541
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
Ngày tải lên :
16/02/2014, 09:20
... GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA GGGGGGIGGGIIGGGIIG ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG ... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG...
- 20
- 689
- 0