focussed ultrasound is good at triaging body cavities

Is it true that one who is good at English doc

Is it true that one who is good at English doc

... written English However, this is a somewhat simplistic view As will be analyzed below, the acquisition of good writing skills requires not just a good command of the grammatical system of English but ... elaborate his ideas or explanations to get his message across, leaving no scope for misunderstanding or interpretation of any type This makes an enormous demand on the writer indeed So in his treatment ... content of his paper is excellent He is therefore expected to exploit whatever kind of knowledge he has acquired, be it his general knowledge, his knowledge of current affairs or his specialist knowledge...

Ngày tải lên: 21/07/2014, 20:20

11 407 0
Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx

Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx

... medications This finding was statistically significant at months, but not at 12 months, although the 12-month trend was towards a benefit of food assistance This is an important finding, given that ... analysis (’as-treated’ analysis) We also performed a sensitivity analysis that was ‘intention to treat’, including subjects based on their enrollment status at the time of baseline evaluation This ... eating at the households in this study was six Furthermore, the ration is not targeted specifically to individuals with HIV infection, but is rather a family support Despite these issues, that...

Ngày tải lên: 10/08/2014, 05:21

8 439 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... that inhibition of the ERK pathway is sufficient to induce apoptosis It is unclear why the mutant is defective at causing pyroptosis, but it is presumably because LF-K518E ⁄ E682G has a diminished ... whereas intoxicated macrophages from certain strains of mice are rapidly killed by pyroptosis Pyroptosis differs from apoptosis in that it is a proinflammatory form of cell death that depends on ... cleavage of distinct substrates To summarize, we have isolated an LF mutant that is impaired in its ability to activate the Nlrp1b inflammasome, but remains able to cause apoptosis in a melanoma...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... CAAATCTATGATTTCTTAAGGGCCA AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG ... GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC...

Ngày tải lên: 18/02/2014, 06:20

15 475 0
Tài liệu THE MEDICAID EXPANSION IS GOOD MEDICINE FOR MISSOURI pptx

Tài liệu THE MEDICAID EXPANSION IS GOOD MEDICINE FOR MISSOURI pptx

... federal match in the current Missouri Medicaid program where funds are generally matched at about a 61% rate.14 The State estimates that the Medicaid expansion would bring in approximately $15.7 ... hospitals, pharmacists, and nursing homes in order to receive federal matching funds through the Missouri Medicaid program State estimates indicate that 45% of the limited state match needed for ... revenue.30 Other States also estimate that the Medicaid Expansion Will Save Money: Missouri’s estimated cost-savings are not surprising given that other states have similarly estimated substantial...

Ngày tải lên: 21/02/2014, 14:20

16 343 0
Báo cáo khoa học: Pyruvate metabolism in rat liver mitochondria What is optimized at steady state? pptx

Báo cáo khoa học: Pyruvate metabolism in rat liver mitochondria What is optimized at steady state? pptx

... Oxaloacetate + H2O fi Citrate + CoASH Pyruvate + ATP + CO2 fi Oxaloacetate + ADP + Pi Citrate fi Isocitrate Isocitrate fi Citrate Isocitrate + NAD+ fi -Oxoglutarate + NADH + H+ + CO2 -Oxoglutarate + ... Pi fi Succinate + GTP + CoASH Succinate + FAD fi Fumarate + FADH2 Fumarate + H2O fi Malate Malate fi Fumarate + H2O Malate + NAD+ fi Oxaloacetate + NADH + H+ Oxaloacetate + NADH + H+ fi Malate + NAD+ ... pyruvate metabolism without any experimental information, and to verify what conclusions could be drawn at that stage Table lists the reactions we considered for pyruvate metabolism in isolated...

Ngày tải lên: 16/03/2014, 14:20

10 324 0
Why is their recovery better than ours? (Even though neither is good enough) pptx

Why is their recovery better than ours? (Even though neither is good enough) pptx

... (remember that date) This is because the UK economy has been largely stalled since then, while the US continued on its recovery trend At this point, the US GDP is back to its pre-crisis level, ... the crisis period (through 2010) This is another way of showing that inflation expectations remain well-anchored 12 The difference is not because markets decided to start expecting deflation ... estimates on both sides of the Atlantic of the impact on markets and the broader economy of a given amount of QE.3 That is, our best guess is that the transmission of monetary policy stimulus is...

Ngày tải lên: 29/03/2014, 09:20

18 228 0
Federal Reserve Bank of New York Staff Reports: What Fiscal Policy Is Effective at Zero Interest Rates? pot

Federal Reserve Bank of New York Staff Reports: What Fiscal Policy Is Effective at Zero Interest Rates? pot

... to promise future inflation at date t < T e , but then to renege on this promise at data t ≥ T e since at that time the bank can achieve both zero inflation and set output at trend, which is the ... What is nice about this interpretation is that rt can now be mapped into the wedge between a risk-free interest rate and an interest rate paid on risky loans Both rates are observed in the data ... it is the one-period risk-free nominal interest rate12 , π t is inflation, rt is an exogenous shock, ˆ and Et is an expectation operator and the coefficient is σ > 013 Yt is output in log deviation...

Ngày tải lên: 29/03/2014, 13:20

36 571 0
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx

Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx

... amplified by PCR (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattatttatacc) using the Platinum® Taq DNA-polymerase (Invitrogen) The ... codon optimised sequence Codon optimisation of the entire sequence even led to at least 10-fold higher expression levels compared to the chimeric constructs, indicating that codon optimisation seems ... optimised fragment resulted in intermediate expression levels and not in an all or none phenomenon In summary, these findings indicate that premature polyadenylation is the major mechanism responsible...

Ngày tải lên: 18/06/2014, 18:20

10 409 1
Báo cáo hóa học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" ppt

Báo cáo hóa học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" ppt

... amplified by PCR (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5'-tcgacctcgagttagttactaaatgcaatattatttatacc) using the Platinum® Taq DNA-polymerase (Invitrogen) The ... codon optimised sequence Codon optimisation of the entire sequence even led to at least 10-fold higher expression levels compared to the chimeric constructs, indicating that codon optimisation seems ... optimised fragment resulted in intermediate expression levels and not in an all or none phenomenon In summary, these findings indicate that premature polyadenylation is the major mechanism responsible...

Ngày tải lên: 20/06/2014, 01:20

10 407 0
Lạc quan theo cách của Life Is Good ppt

Lạc quan theo cách của Life Is Good ppt

... người đồng sáng lập nên Life is good cho biết "Trong công ty có thống chung Nó giúp định hướng cho toàn thể nhân viên họ có mục đích lớn hơn” • Ngày hội Life is good tổ chức vào năm 2003 kiện ... nhuận công ty, người tạo sân chơi Life is good cung cấp liệu pháp dựa trò chơi dành cho trẻ em phải chiến đấu với nghèo đói, bạo lực bệnh tật • Life is good tạo trang web tùy chỉnh chuyên gây ... cực anh với mơ mộng hão huyền "Một số người hình dung công việc Life is good dễ ăn kem, thứ đến với thật dễ dàng trò chơi Frisbee”, Bert Jacobs cho biết "Thực tế phải cạnh tranh Chúng lạc quan...

Ngày tải lên: 28/06/2014, 09:20

5 288 0
Báo cáo y học: "Combined antibiotic and free radical trap treatment is effective at combating Staphylococcus-aureus-induced septic arthritis" ppt

Báo cáo y học: "Combined antibiotic and free radical trap treatment is effective at combating Staphylococcus-aureus-induced septic arthritis" ppt

... treated animals, of erosions is not surprising, bearing in mind that the treatment was started three days after inoculation of bacteria This was done in an attempt to reflect the clinical situation ... Foundation, the Swedish Medical Research Council, the King Gustaf V 80 Years Foundation, the Swedish Association against Rheumatism, Börje Dahlins Foundation, and Rune and Ulla Amlövs Foundation ... All treatments were initiated on day following intravenous inoculation of bacteria and continued until day 10 Positive values indicate amelioration of arthritis and negative values indicate increased...

Ngày tải lên: 09/08/2014, 03:24

5 257 0
Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

... localization sand seen in the human specimen shows simiSectioned en face, thisto thatrat lumbar vertebral disc lar asporin localization to that seen in the human disc The greatest asporin presence is ... derived from surgical disc procedures performed on individuals with herniated discs and degenerative disc disease Surgical specimens were transported to the laboratory in sterile tissue culture medium ... to remove all granulation tissue and to sample only disc tissue Non-surgical control donor disc specimens were obtained via the National Cancer Institute Cooperative Human Tissue Network (CHTN);...

Ngày tải lên: 09/08/2014, 14:20

7 235 0
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

... adaptation in Arabidopsis, and this idea is consistent with results from P patens [22] Since Rhodobacter TSPO is a negative regulator of photosynthetic genes [17], it is possible that AtTSPO operates ... hypothesis At the present moment it is not clear which pathway is used during AtTSPO relocation during salt-stress However our data indicate that AtTSPO changes its localization during stress, and that ... suggesting that disturbances in tetrapyrrole biosynthesis or accumulation affect AtTSPO mRNA expression AtTSPO localization depends on the translational start site used AtTSPO (At2 g47770) encodes...

Ngày tải lên: 11/08/2014, 11:21

17 369 0
Báo cáo y học: "Inhibition of breathing after surfactant depletion is achieved at a higher arterial PCO2 during ventilation with liquid than with gas" ppsx

Báo cáo y học: "Inhibition of breathing after surfactant depletion is achieved at a higher arterial PCO2 during ventilation with liquid than with gas" ppsx

... comparison between different ventilatory patterns [11] Discussion This study shows that in cats ventilated with gas, inspiratory activity is inhibited at higher peak airway pressures and tidal ... The cat's core body temperature, measured as deep rectal temperature, was maintained at 38°C by a heating blanket and an overhead warmer A pretracheal midline incision was performed for preparation ... 6:24 http://respiratory-research.com/content/6/1/24 PEEP, positive end-expiratory pressure A/C ventilation, assist/control ventilation Ti, inspiratory time RR, respiratory rate Paw, airway pressure...

Ngày tải lên: 12/08/2014, 18:21

8 257 0
GOOD IN / GOOD AT

GOOD IN / GOOD AT

Ngày tải lên: 29/10/2014, 04:00

2 163 0
19030 good at   not good at   can do

19030 good at not good at can do

... TO BE GOOD AT /NOT GOOD AT; CAN ? ...

Ngày tải lên: 26/08/2016, 17:50

2 109 0
ed003 babies are good at grammar

ed003 babies are good at grammar

... grammatical information from the age of five months up At other  well  from  when up 12 ten months an infant can use information about how the order of how 13 nouns and verbs, and even at the ... of grammar almost before they can talk well At first, scientists could not understand how babies were being able being to this To find out, scientists had to invent such a new language such and ... which should not be there Write this word in the box next to the line If the line is correct put a tick  in the box Scientists have succeeded in proving what every other parent knows: babies...

Ngày tải lên: 30/08/2016, 09:15

2 173 0
w