... fibroblast-like synoviocytes (FLSs), proinflammatory cytokine production by macrophages, and activation of osteoclasts–likely underlies the chronic inflammatory stage of RA Elucidation of the cellular responses ... improved therapeutic index for the treatment of RA Accumulating evidence underscores the importance of monocyte lineage cells in the chronic inflammatory stage of RA Upon migration to tissues, monocytes ... Nat Clin Pract Rheumatol 2009, 5:1 Campbell IK, Rich MJ, Bischof RJ, Hamilton JA: The colony-stimulating factors and collagen-induced arthritis: exacerbation of disease by M-CSF and G-CSF and...
Ngày tải lên: 12/08/2014, 11:23
... a tool in the study of mechanism exemplified by a comparison of the catalytic-site structure and characteristics of cathepsin B and papain pH-dependent kinetics of the reactions of cathepsin B ... considerable influence on specificity and activity In this article, the domain plasticity has been correlated with the activity of the enzyme, which has the catalytic site at the interface of the ... sequence and guidelines from the electron density maps for the protein Degeneracy of the primer sequences was fixed on the basis of frequency of occurrence of a particular DNA codon for an amino acid...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: "On the Evaluation and Comparison of Taggers: the Effect of Noise in Testing Corpora." doc
... the tagger and the test corpus have the correct tag, the tag is correctly evaluated as right W h e n the test corpus has the correct tag and the tagger gets it wrong, the occurrence is correctly ... order to constrain as much as possible the intervals; the statistical significance of the interval overlappings; a more informed (and less conservative) criterion to reject/accept the hypothesis ... 1, i.e the cases in which the tagger got the right disambiguation independently from the tagging of the test set: (1) x=(1 -C) t+Cu The equation of the observed performance can also be extracted...
Ngày tải lên: 08/03/2014, 05:21
Chronicles of England, Scotland and Ireland (2 of 6): England (1 of 12) William the Conqueror pdf
... Maunt, which he burnt with the church of our ladie, and an ankresse inclosed in the wall thereof as an holie closet, for Chronicles of England, Scotland and Ireland, vol 27 the force of the fire ... Carbonelle Charles Chereberge Chawnes Chaumont Caperoun Cheine Curson Couille Chaiters Cheines Cateray Cherecourt Cammile Clerenay Curly Cuily Clinels Chaundos Courteney Clifford D Denauille Dercy Diue ... Cribett Creuquere Corbine Corbett Chaundos Chaworth Cleremaus Clarell Chopis Chaunduit Chantelow Chamberay Cressy Curtenay Conestable Cholmeley Champney Chawnos Comiuile Champaine Careuile Carbonelle...
Ngày tải lên: 24/03/2014, 00:20
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)
... Goddess The goddesses is the god of nature and no human characteristics of particular characteristics of the Mother The characteristics of the Mother is manifest in grades god, as the Au Co Mother of ... profess Name: Mother of Land, Mother of Water, Mother of Rice, Mother of the tree …With spiritual faith in the power of Mother - the Creator, sponsor for the survival and growth of the universe, ... and worship Mother belief is seen as a template layer to The Holy of Mother and development 1.1.2.3 The Pantheon of the Mother Goddess Religion It might be called the dawn of the Holy of Mother...
Ngày tải lên: 20/04/2014, 16:09
Báo cáo y học: "Pros and cons of estimating the reproduction number from early epidemic growth rate of influenza A (H1N1) 2009" potx
... Labour and Welfare of Japan decided not to mandate its local health sectors to notify all the confirmed cases, and thereafter the local sectors gradually ceased counting all the cases The first pandemic ... This retrospective study highlights the importance of incorporating the concept of heterogeneous risks of infection and death in the context of the assessment of pandemic potential List of abbreviations ... structured data and a clear identification of the correct exponential growth time window In the context of the pandemic from 2009, gathering age-specific transmission dynamics information is of the utmost...
Ngày tải lên: 13/08/2014, 16:20
albo - in and out of crisis; the global financial meltdown and left alternatives (2010)
... had the intent to “narrow the political and economic choices of those in power” such that “policy choices get reduced to Pepsi or Coke.”12 The successful pursuit of these objectives has been the ... beyond the demand for re-regulation, which, they argue, will not solve the economic or environmental crisis, and must instead demand public control of the banks and the financial sector, and of the ... over the course of the crisis And despite the fierce debates about how to address the financial crisis, and the profound restructuring in the auto, electronics, pulp and paper and steel sectors,...
Ngày tải lên: 01/11/2014, 18:55
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227
... affect the lives of people) as profess Name: Mother of Land, Mother of Water, Mother of Rice, Mother of the tree All the way out there not in Mother the foundation of the world that just means caring, ... Holy of Mother is separate natural worship Goddess The goddesses is the god of nature and no human characteristics of particular characteristics of the Mother The characteristics of the Mother is ... especially for the agricultural population was human mind into the "Mother" to express the reverence , the respect of the people 1.1.2.2 The cult of Mother Goddess Custom According to GS Ngo Duc...
Ngày tải lên: 30/03/2015, 14:55
Case study 10 organization and role of HR THE ROLE OF HR AT INTERNATIONAL AID
... affected by the reorganization are shown): Chief Executive Director of Operations Director of Finance Director of Fundraising Head of Operations Planning* Financial Accountant Management Accountant* ... over-staffed; the Head of IT and Head of Personnel were quite capable of carrying out their roles without him ● The Head of IT was effective and could contribute much more given better leadership ● The ... It can be assumed that the strategic goals of the charity are to plan and deliver more successful projects, to run the charity as a whole as well as individual projects more cost-effectively, and...
Ngày tải lên: 11/11/2016, 15:55
Case study 11 organization and role of HR THE HR FUNCTION AT CONRAD VALVES
... per cent for operatives and 15 per cent for technical and administrative staff The failure to retain a number of recent technical and operative recruits is worrying and may have contributed to the ... tempting to focus on the strategic business partner concept but too much should not be made of this The emphasis should be on the practical aspects of service delivery within the framework of a development ... Managing Director but again, a business case is necessary, which might refer to the enhanced contribution a head of HR can make with the scope directly to gain knowledge of the factors affecting business...
Ngày tải lên: 11/11/2016, 15:55
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 ... fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... targeting of v-KIND RasGEF (an activator of the Ras pathway) to MAP2 associated with the dendritic microtubule cytoskeleton The present study indicates that the conserved amino acid sequence of the...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell ... reducing the basal level of Itch reduces cell survival and increases caspase activity, consistent with increased tBid levels in these cells Interestingly, Itch interacts specifically with tBid, and ... stimulation activates the nuclear factor kappa-light-chainenhancer of activated B cells (NFjB) pathway, inducing expression of Mcl-1, which also blocks recruitment of Bax and Bak to the mitochondria...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... difference of the log of the GDP price deflator; the fourquarter difference of the log of CoreLogic house price index; the four-quarter difference of the log of the S&P 500 stock price index; the 10-year ... such an approach, we include a number of macroeconomic and financial indicators—denoted by the vector mt —in the regression in order to control for the cyclical changes in macroeconomic conditions ... other bank-speci c characteristics, denoted by the vec- tor Xit The specification also includes a bank-speci c fixed effect ηi , which controls for the fact that the average level of bank-specific...
Ngày tải lên: 17/02/2014, 03:20
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled ... (E) Cells of the fibroblastic line 2C4 were treated with empty lipids (E lip), hairpin decoy ODN, control ODN (con) and curcumin (40 lM) (curc) and the dead cells were counted after 48 h of culture ... SW480 colon carcinoma cell line with the STAT3 decoy ODN (A) Efficient incorporation of FITC-STAT3 decoy ODN into SW480 cells using decoy ⁄ lipid complexes After h of incubation, cells were placed...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA ... genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT ... GGG GAA C The PCR reaction was done as described above The amplified PCR product was inserted into the EcoRI and KpnI sites of the vector pPIC´ ZaA (Invitrogen) and the sequence of the product was...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation ... prefers GlcNAc at the nonreducing ends, i.e -GlcNAc-GlcNAc-linkage, the action on which results in the release of GlcNAc and products with GlcNAc at the reducing ends The observed decrease in ... [28] Contrary to this, the speci c activity of pronase indicated that chitosan dissolved in aqueous acetic acid (1%) and was the best solvent when compared to formic and lactic acids In acetic acid,...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... mitoDC-81, which showed the expected logarithmic response of the electrode to cation concentra- Results Synthesis of mitoDC-81 The compound of interest, mitoDC-81 2, was prepared by reaction of the ... mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA, and the duration of the experiments ... DNA and high micromolar concentrations of mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA ... detected almost 50% of the crude extract nitrite reducing activity in the D desulfuricans ATCC 27774 soluble fraction and suggested that most of the activity could be caused by interference of the...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... inhibition and hemagglutinatin study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii ... EDTA, and mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions ... NaCl/Tris containing 10 mm CaCl2 at C The clarified serum (10 mL) was applied and washed with NaCl/Tris containing M NaCl and 10 mm CaCl2 at C, until the A280 of the effluent was 0.002 The column...
Ngày tải lên: 21/02/2014, 00:20