fl 7th c one of the wives of muhammad

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Ngày tải lên : 07/11/2012, 14:44
... is the characteristics of this situation type that influence the forms of language that realize the genre So the context of situation (register) is the second aspect of social context that influences ... into the role of metaphor in description of emotion in poetic discourse Levels of Language While SFL accounts for the syntactic structure of language, it places the function of language as central ... he was careless, a traffic accident occurred [2b] His carelessness caused a traffic accident Taking condition as process To express the meaning of condition in the congruent way, connectives...
  • 53
  • 1K
  • 3
Computer illiteracy as one of the main problem of business student

Computer illiteracy as one of the main problem of business student

Ngày tải lên : 26/10/2013, 17:15
... learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient allocation of application programs, - ... alternative of solving the problem, what can we suggest? We have another alternative, which is called “Simplification of access to computer classes.” We mean the organization of computer classes or computer ... which can be solved with the help of PC faster And all we know that computer literacy is on of the main requirement at employment Thus we see that the problem of computer illiteracy is one of the...
  • 4
  • 351
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Ngày tải lên : 19/02/2014, 05:20
... eukaryotic c class cytochromes [27]; anions exert a strong influence on the lysine residues of cytochrome c, and significantly affect the structure and the functional properties of the protein, as the conserved ... modulates the structure of the A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... Fig Fig Absorbance at 695 nm of acid-denatured cytochrome c in the presence of increasing sulfate (s) and selenate (d) concentrations The optical absorbance of native cytochrome c (—) at pH 7.0...
  • 11
  • 487
  • 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20
... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation ... nonreducing ends, i.e -GlcNAc-GlcNAc-linkage, the action on which results in the release of GlcNAc and products with GlcNAc at the reducing ends The observed decrease in DA value of LMWC is due to the ... difference in chemical shift values of C1 and C4 indicated a conformational change of the glycosidic linkage in LMWC Multiplicity of the peak corresponding to C4 is independent of DA and is associated...
  • 11
  • 673
  • 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Ngày tải lên : 19/02/2014, 16:20
... The torque was created by external forces acting on the two groups of four carbon atoms each The first group included the Ca atoms of cK18, cI19, cT20 and cK21, and the second group Ca atoms of ... from the N-end of c subunit (cA1–cK24) and 43 residues from its C- end (cT230– cL272) The chosen portion included a major part of the coiled-coil region of c and the complete a-helical C- terminus ... distance of 1.2 nm The system was equilibrated during ns, and then the rotation of c was forced by a constant torque applied to the coiled-coil portion of c at the level of cK18–cK21 and cD233–cS236...
  • 9
  • 546
  • 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Ngày tải lên : 20/02/2014, 23:20
... that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 ... nonspeci c and toxic effects in animals To ascertain that the effects of these agents, on the catalytic activity and subunit composition of CytOX were related to their hypoxia-speci c effects, we ... also the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspecific...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Ngày tải lên : 21/02/2014, 00:20
... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because the ... erythrocytes was marked by a 9-O-acetyl sialic acid-speci c lectin purified from the hemolymph of the snail Achatina fulica [64,66] Lectins are used for verification of the sugar specificity of the...
  • 8
  • 616
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Ngày tải lên : 21/02/2014, 01:21
... and (c) inactivation of EIIGlc is accelerated in the presence of Glc (see below) Although the dominant reactivity of Cys421 compromised the labelling of other active-site residues, the glucose ... II-BGlc, a glucose receptor of the bacterial phosphotransferase system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci ... biphasic to a monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) of the analogues 1a)3d was carried out at 30 C Rate constants...
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... from the cDNA #911 using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned ... following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI digested PCR product was cloned as a fusion with the GAL4 activation ... primers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1 vector, or...
  • 10
  • 464
  • 0
Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Ngày tải lên : 06/03/2014, 22:21
... indicating that proteolytic modifications of the D-loop affect the state of the interdomain cleft [5,17] The D-loop of actin can be specifically cleaved with two bacterial proteases One of them ... the open cleft conformation The cleavage within the D-loop enhances the nucleotide exchange [17] and increases accessibility of the cleft to limited proteolysis [5], which characterizes the cleft ... stabilizing the filament by closing the cleft in actin subunits [49,50] Hence, the increase in the thermal stability of ECP-cleaved F-actin and the disappearance of the shoulder on the DSC profile can...
  • 11
  • 482
  • 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Ngày tải lên : 07/03/2014, 05:20
... ‘nested PCR’, using the first PCR product as template To make use of the BamHI site in the vector and the XbaI site in the EhMGL1 gene, the product of the nested PCR was replaced with the corresponding ... vivo activity of the two isozymes in the parasite, we measured speci c activities of MGL in the amoebic extracts using two representative physiological substrates, i.e Met and Hcy The speci c activities ... toxicity to the cell The fact that EhMGL2, which is more active in the degradation of TFM, is less sensitive than EhMGL1 seems to contradict the notion that the product of the degradation is the enzyme...
  • 13
  • 406
  • 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Ngày tải lên : 07/03/2014, 12:20
... 5¢-CACGATGATGGATGAAATGGCG TC-3¢ For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢ Cycling conditions were 94 C for min, followed by 35 cycles of 94 C for 30 s, 54 C for ... 10 lm of each of the following primers For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG ... first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢...
  • 10
  • 639
  • 0
Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Ngày tải lên : 07/03/2014, 15:20
... noticed earlier [36,37] Figure shows the effect of the FMN concentration on the reconstitution of the activity of the reduced SH Addition of about 80 nM FMN induced half maximal activity Table The ... NADHK3Fe(CN)6 activity is the speci c activity compared to that of untreated enzyme Bound, acid-labile FMN from the protein inside the dialysis bag, corrected for the contribution of the free FMN in the ... Scienti c Research (NWO), the Deutsche Forschungsgemeinschaft, the Fonds der Chemischen Industrie, EU-project BIO4-98-0280 and the European Union Cooperation in the field of Scienti c and Technical...
  • 8
  • 371
  • 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Ngày tải lên : 07/03/2014, 15:20
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
  • 9
  • 414
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Ngày tải lên : 07/03/2014, 16:20
... the third encoded methionine [9], the sequence of the human B1wt, truncations and chimeras of both were cloned into the BamHI and the XhoI sites of the pcDNA5 ⁄ FRT vector from Invitrogen Each ... accumulation of total IPs for 30 at 37 C compared to the IP content of control cells that had remained at C There was a clear correlation between the agonist-inducible internalization and the ... recognition site because the presence of detergent or membrane lipids influences the formation of a helical structure These authors proposed that activation of the receptor, and subsequently of...
  • 12
  • 595
  • 0
The Female Brain is one of the most-talked-about books of the year. ppt

The Female Brain is one of the most-talked-about books of the year. ppt

Ngày tải lên : 08/03/2014, 23:20
... with a loved one can evaporate because of the way the chemicals in those substances affect the brain Your immediate reality can change in an instant If chemicals acting on the brain can create different ... together the findings of innumerable articles and books, both technical and popular, along with accounts of patients she treated at her clinic Given the character— and rancor of our dichotomous ... to touch a toy cow The mother stood off to the side Every move, glance, and utterance was recorded Very few of the girls touched the forbidden object, even though their mothers never explicitly...
  • 302
  • 491
  • 1
The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

Ngày tải lên : 13/03/2014, 21:57
... is considered acceptable The total cost of food imported by the neediest countries rose 25 percent in 2007.7 Some Blame African Hunger on Rejection of Agricultural Biotechnology According to the ... population At the same time, the FAO calls for a cautious, case-by-case approach to determine the benefits and risks of each individual biotech crop genetic event and to address the “legitimate concerns ... export-led economic growth.13 Increased Production and Plantings Since the first commercialized crop in 1996, the world’s farmers have consistently increased their plantings of biotech crops by...
  • 28
  • 286
  • 0
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Ngày tải lên : 16/03/2014, 00:20
... according to established protocols [50] Experimental protocols were reviewed by the Animal Care Committee of Dalhousie University in accordance with the recommendations of the Canadian Council ... (2001) Cloning and sequence of the gene encoding the muscle fatty acid binding protein from the desert locust, Schistocerca gregaria Insect Biochem Mol Biol 31, 553–562 18 Ceciliani F, Monaco HL, ... utilization of fatty acids, intracellular targeting of fatty acids to speci c organelles and metabolic pathways, and the protection of cellular structures from the detergent effects of fatty acids [10–14]...
  • 11
  • 402
  • 0