fl 1st c biblical woman and mother of john the baptist
Báo cáo sinh học: " Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc
Ngày tải lên :
18/06/2014, 22:20
... synthetic oligonucleotides -/+ (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') and +/- (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') ... the synthetic oligonucleotide GS945 as template (5'GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAG TTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC -3'), the filling primer (5'-CTGGTCAACTGGGGAGCCT-3') ... (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') that contained a point mutation in the first or second binding site, respectively (mutated base indicated by boldface and underline)...
- 10
- 410
- 0
báo cáo hóa học:" Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc
Ngày tải lên :
20/06/2014, 04:20
... synthetic oligonucleotides -/+ (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') and +/- (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') ... the synthetic oligonucleotide GS945 as template (5'GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAG TTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC -3'), the filling primer (5'-CTGGTCAACTGGGGAGCCT-3') ... (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') that contained a point mutation in the first or second binding site, respectively (mutated base indicated by boldface and underline)...
- 10
- 254
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
Ngày tải lên :
18/02/2014, 16:20
... a tool in the study of mechanism exemplified by a comparison of the catalytic-site structure and characteristics of cathepsin B and papain pH-dependent kinetics of the reactions of cathepsin B ... considerable influence on specificity and activity In this article, the domain plasticity has been correlated with the activity of the enzyme, which has the catalytic site at the interface of the ... sequence and guidelines from the electron density maps for the protein Degeneracy of the primer sequences was fixed on the basis of frequency of occurrence of a particular DNA codon for an amino acid...
- 14
- 634
- 0
Báo cáo khoa học: "On the Evaluation and Comparison of Taggers: the Effect of Noise in Testing Corpora." doc
Ngày tải lên :
08/03/2014, 05:21
... the tagger and the test corpus have the correct tag, the tag is correctly evaluated as right W h e n the test corpus has the correct tag and the tagger gets it wrong, the occurrence is correctly ... order to constrain as much as possible the intervals; the statistical significance of the interval overlappings; a more informed (and less conservative) criterion to reject/accept the hypothesis ... 1, i.e the cases in which the tagger got the right disambiguation independently from the tagging of the test set: (1) x=(1 -C) t+Cu The equation of the observed performance can also be extracted...
- 6
- 586
- 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)
Ngày tải lên :
20/04/2014, 16:09
... Goddess The goddesses is the god of nature and no human characteristics of particular characteristics of the Mother The characteristics of the Mother is manifest in grades god, as the Au Co Mother of ... profess Name: Mother of Land, Mother of Water, Mother of Rice, Mother of the tree …With spiritual faith in the power of Mother - the Creator, sponsor for the survival and growth of the universe, ... and worship Mother belief is seen as a template layer to The Holy of Mother and development 1.1.2.3 The Pantheon of the Mother Goddess Religion It might be called the dawn of the Holy of Mother...
- 18
- 813
- 0
Báo cáo y học: "Pros and cons of estimating the reproduction number from early epidemic growth rate of influenza A (H1N1) 2009" potx
Ngày tải lên :
13/08/2014, 16:20
... Labour and Welfare of Japan decided not to mandate its local health sectors to notify all the confirmed cases, and thereafter the local sectors gradually ceased counting all the cases The first pandemic ... This retrospective study highlights the importance of incorporating the concept of heterogeneous risks of infection and death in the context of the assessment of pandemic potential List of abbreviations ... structured data and a clear identification of the correct exponential growth time window In the context of the pandemic from 2009, gathering age-specific transmission dynamics information is of the utmost...
- 13
- 262
- 0
albo - in and out of crisis; the global financial meltdown and left alternatives (2010)
Ngày tải lên :
01/11/2014, 18:55
... had the intent to “narrow the political and economic choices of those in power” such that “policy choices get reduced to Pepsi or Coke.”12 The successful pursuit of these objectives has been the ... beyond the demand for re-regulation, which, they argue, will not solve the economic or environmental crisis, and must instead demand public control of the banks and the financial sector, and of the ... over the course of the crisis And despite the fierce debates about how to address the financial crisis, and the profound restructuring in the auto, electronics, pulp and paper and steel sectors,...
- 145
- 268
- 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227
Ngày tải lên :
30/03/2015, 14:55
... affect the lives of people) as profess Name: Mother of Land, Mother of Water, Mother of Rice, Mother of the tree All the way out there not in Mother the foundation of the world that just means caring, ... Holy of Mother is separate natural worship Goddess The goddesses is the god of nature and no human characteristics of particular characteristics of the Mother The characteristics of the Mother is ... especially for the agricultural population was human mind into the "Mother" to express the reverence , the respect of the people 1.1.2.2 The cult of Mother Goddess Custom According to GS Ngo Duc...
- 106
- 507
- 0
Case study 10 organization and role of HR THE ROLE OF HR AT INTERNATIONAL AID
Ngày tải lên :
11/11/2016, 15:55
... affected by the reorganization are shown): Chief Executive Director of Operations Director of Finance Director of Fundraising Head of Operations Planning* Financial Accountant Management Accountant* ... over-staffed; the Head of IT and Head of Personnel were quite capable of carrying out their roles without him ● The Head of IT was effective and could contribute much more given better leadership ● The ... It can be assumed that the strategic goals of the charity are to plan and deliver more successful projects, to run the charity as a whole as well as individual projects more cost-effectively, and...
- 4
- 475
- 0
Case study 11 organization and role of HR THE HR FUNCTION AT CONRAD VALVES
Ngày tải lên :
11/11/2016, 15:55
... per cent for operatives and 15 per cent for technical and administrative staff The failure to retain a number of recent technical and operative recruits is worrying and may have contributed to the ... tempting to focus on the strategic business partner concept but too much should not be made of this The emphasis should be on the practical aspects of service delivery within the framework of a development ... Managing Director but again, a business case is necessary, which might refer to the enhanced contribution a head of HR can make with the scope directly to gain knowledge of the factors affecting business...
- 4
- 1.1K
- 4
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"
Ngày tải lên :
02/11/2012, 09:56
... presence or absence of either marker The presence of HCV RNA in the absence of anti-HCV antibodies is strongly indicative of acute HCV infection, which will be confirmed by seroconversion (i.e the ... result, the exact prevalence of which is unknown Int J Med Sci 2006, Chronic hepatitis C In patients with clinical or biological signs of chronic liver disease, chronic hepatitis C is certain ... for the use of HCV virological tools in the treatment of chronic hepatitis C, according to the HCV genotype: genotype (A), genotypes and (B), and genotypes 4, and (C) Int J Med Sci 2006, HCV...
- 6
- 612
- 0
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS
Ngày tải lên :
29/01/2014, 00:23
... through association of ideas I.5.3 Vocabulary teaching according to the Communicative approach (CLT) Communicative Language Teaching (CLT) is an approach to the teaching of second and foreign ... adequate proficiency to communicate The advantage it brings in is that teaching practice helps students develop their communicative competence in an authentic context Thus, in the classroom, CLT often ... and/ or reading, followed by exercises to practise grammar and vocabulary These focus on accuracy and correct answers Finally, there are activities which are more open-ended and develop fluency...
- 42
- 1.3K
- 3
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
Ngày tải lên :
14/02/2014, 19:20
... grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 ... fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... targeting of v-KIND RasGEF (an activator of the Ras pathway) to MAP2 associated with the dendritic microtubule cytoskeleton The present study indicates that the conserved amino acid sequence of the...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
Ngày tải lên :
16/02/2014, 09:20
... of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell ... reducing the basal level of Itch reduces cell survival and increases caspase activity, consistent with increased tBid levels in these cells Interestingly, Itch interacts specifically with tBid, and ... stimulation activates the nuclear factor kappa-light-chainenhancer of activated B cells (NFjB) pathway, inducing expression of Mcl-1, which also blocks recruitment of Bax and Bak to the mitochondria...
- 12
- 718
- 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx
Ngày tải lên :
18/02/2014, 04:20
... that low concentrations of SDS have the ability to mimic the necessary conditions for the formation of aggregated species, whereas higher concentrations [well above the critical micelle concentration ... which only small species can be detected, the monomer state cannot be discerned by light scattering in the presence of the much larger oligomer complexes because of the strong size dependency of ... electrophoresis and a wide range of spectroscopic techniques Suitable methods for investigation of the secondary structure and morphology of such structures, however, require the presence of...
- 10
- 561
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
Ngày tải lên :
18/02/2014, 08:20
... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled ... (E) Cells of the fibroblastic line 2C4 were treated with empty lipids (E lip), hairpin decoy ODN, control ODN (con) and curcumin (40 lM) (curc) and the dead cells were counted after 48 h of culture ... SW480 colon carcinoma cell line with the STAT3 decoy ODN (A) Efficient incorporation of FITC-STAT3 decoy ODN into SW480 cells using decoy ⁄ lipid complexes After h of incubation, cells were placed...
- 11
- 558
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds 1994 Construction ... endothelial cells through an endothelial-to-mesenchymal transition during early development [33] The presence of these cells may cause a dysfunctional cardiac flow and cause the sudden death of the ... by the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium-specific...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
Ngày tải lên :
19/02/2014, 06:20
... 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA ... genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT ... GGG GAA C The PCR reaction was done as described above The amplified PCR product was inserted into the EcoRI and KpnI sites of the vector pPIC´ ZaA (Invitrogen) and the sequence of the product was...
- 14
- 650
- 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
Ngày tải lên :
19/02/2014, 12:20
... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation ... prefers GlcNAc at the nonreducing ends, i.e -GlcNAc-GlcNAc-linkage, the action on which results in the release of GlcNAc and products with GlcNAc at the reducing ends The observed decrease in ... [28] Contrary to this, the speci c activity of pronase indicated that chitosan dissolved in aqueous acetic acid (1%) and was the best solvent when compared to formic and lactic acids In acetic acid,...
- 11
- 673
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
Ngày tải lên :
20/02/2014, 01:20
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
- 15
- 597
- 0