... different and balancingfeatures Gawaine is outgoing and quick to act, but he is balanced by Gaheris who isreclusive and slow to action Agravaine is sadistic and selfish, but he is balanced by Garethwho ... sadistic and selfish, but he is balanced by Garethwho is kind and generous They compliment each other and together are stronger thanthey can ever be apart ...
Ngày tải lên: 02/04/2014, 17:58
... I acquired concerned fundamental concepts in physics and mathematics, quantum mechanics and electromagnetic theory, with speci c emphasis on their use in electronic and electro-optical devices ... Emeritus Professor of the Department of Electrical and Computer Engineering, University of California at San Diego A pioneer of microwave laser and optical laser research, his recent research interests ... PRINCIPLES OF LASERS AND OPTICS WILLIAM S C CHANG Professor Emeritus Department of Electrical Engineering and Computer Science University of California San Diego Cambridge,...
Ngày tải lên: 24/04/2014, 16:51
Báo cáo hóa học: " Editorial Petar M. Djuri´ c Department of Electrical and Computer Engineering, " potx
... tracking and joint detection and estimation in wireless communications In “A new class of particle filters for random dynamic systems with unknown statistics,” M´guez et al propose a new ı class ... the performance of the proposed filters in automated speech recognition and speech enhancement, respectively Hainsworth and Macleod in “Particle filtering applied to musical tempo tracking” aim at ... theory and novel applications in communications, tracking, and speech/music signal processing We hope that these papers will not only be of immediate use to practitioners and theoreticians but...
Ngày tải lên: 23/06/2014, 01:20
STOCK ASSESSMENT AND FISHERY EVALUATION REPORT FOR THE GROUNDFISH FISHERIES OF THE GULF OF ALASKA AND BERING SEA/ALEUTIAN ISLANDS AREA: ECONOMIC STATUS OF THE GROUNDFISH FISHERIES OFF ALASKA, 2008 potx
... Economic SAFE Economic Status December 2009 - 22 NPFMC Economic SAFE Economic Status - 23 - December 2009 NPFMC Economic SAFE December 2009 - 24 - Economic Status NPFMC Economic SAFE Economic ... of federal TACs - 18 NPFMC Economic SAFE December 2009 Economic Status - 19 NPFMC Economic SAFE Economic Status December 2009 - 20 NPFMC Economic SAFE December 2009 Economic Status - 21 NPFMC ... Prohibited-Species Bycatch The bycatch of Pacific halibut, king and tanner crab (Chionoecetes, Lithodes and Paralithodes spp.), Pacific salmon (Oncorhynchus spp.), and Pacific herring (Clupea pallasi)...
Ngày tải lên: 23/03/2014, 21:20
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... such an approach, we include a number of macroeconomic and financial indicators—denoted by the vector mt —in the regression in order to control for the cyclical changes in macroeconomic conditions ... bank-speci c characteristics, denoted by the vec- tor Xit The specification also includes a bank-speci c fixed effect ηi , which controls for the fact that the average level of bank-speci c variables ... reaction of bank stock returns to policy-induced interest rate shocks varies across banks, according to key banks characteristics that a priori can be expected to influence that reaction We construct...
Ngày tải lên: 17/02/2014, 03:20
Tài liệu Báo cáo khoa học: Oocyte membrane localization of vitellogenin receptor coincides with queen flying age, and receptor silencing by RNAi disrupts egg formation in fire ant virgin queens ppt
... synthesis of a 691 bp region of the SiVgR gene (amino acid 648–878) using primer set VgRi-f1 (5¢-TAATACGACTCACTATA GGGGCCATCTGCAATTATCAACGCCTTTCTTAACG TC-3¢) and VgRi-r1 (5¢-TAATACGACTCACTATAGGG ACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢), ... sequence) [36] was amplified as template with primer set VgRi-f4 (5¢-TAATACGACT CACTATAGGGCGTGATCAGGTCAAAACGTATTTTC TTCATTT-3¢) and VgRi-r3 (5¢-TAATACGACTCACTATA GGGGCCACAGTCATCCTTTTTATCGCATACTAC-3¢) ... SiVgR-2.3-3-2, 5¢-ACAAGAGCCATTCTCTATGACGGTCTTTC-3¢, and SiVgR-2.3-4r, 5¢-CTGACCTGAGAGCGGATCAGATAT TATATTCAC-3¢, and the conditions were 94 C for min; 28 cycles of 94 C for 30 s, 60 C for and 72 C for...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Department of Health and Human Services 200 Independence Avenue S.W., Washington, D.C. 20201 doc
... 2010, CDC is building a cadre of health protection researchers, research training programs, and centers of excellence that enable multidisciplinary approaches to public health practice Performance ... Intramural Research 10.6% Research Project Grants 53.1% Research & Development Contracts 11.0% Research Training 2.6% Other Research, Superfund, Office of the Director 8.0% 41 Research Management and ... intramural, program of basic and clinical research activities managed by world-class physicians and scientists This intramural research program, which includes the NIH Clinical Center, gives our...
Ngày tải lên: 18/02/2014, 15:20
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... densitometry, which reflects differences in the ratios of the di-, mono- and nonglycosylated PrP In sporadic cases of human Creutzfeldt–Jakob disease, PrPSc shows a characteristic glycopattern with ... were analyzed The percentages of the PrPC bands were calculated as arithmetic means and SE according to the antibody used for PrP detection Calculation of the banding patterns of 16 gels using antibody ... PrPC derived from cortex (c) , cerebellum (cb) and brain stem (bs) of sheep detected by antibodies SAF34 and SAF70, respectively (B) PrPC signals of cortex (c) , cerebellum (cb) and brain stem (bs)...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... presence of an excess of nonspeci c competitor calf thymus DNA mimicking randomsequence natural genetic material that can accommodate the cisplatin adducts regardless of the reactivity 4700 Fig Competition ... DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 to...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously ... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) ... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased ... complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a ... 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The resulting TAP constructs were cloned into the EcoRI site of pHbApr1neo [22] and sequenced fully...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspeci c and...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... bromoacetic acid and 2.5 times faster than by the chemically more reactive iodoacetamide, suggesting some specificity and selectivity of the glucose analogues for EIIGlc Phosphorylation of EIIGlc completely ... glucose receptor of the bacterial phosphotransferase system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci USA 84, ... nonspeci c reagent with equal access to both Cys Whatever the cause, sensitization by Glc cannot be the (trivial) effect of Glc-induced dephosphorylation/deprotection of Cys421, because EIIGlc in...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... sample Speci c primers directed against human sequences for c- myc and GAPDH and PCR conditions were as previously described [20] Analysis of c- myc gene transcription by nuclear runoff assay To ... obtained using lL of the RT products after 30 cycles of PCR amplification The lower part of panel A, and panels B, C report the expression of c- myc mRNA levels detected by[32P]dCTP-PCR Individual ... each primer pairs by using 0.5 lCi of [a-32P]dCTP (speci c activity 3000 CiÆmmol)1, Amersham Pharmacia Biotech) and establishing the point at which exponential accumulation plateaus Using 30 PCR...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx
... which in some organisms is two separate proteins CcmH and CcmI [50], appears to be involved in both heme handling ⁄ ligation and reductant provision [2] CcmH CcmE p-side CcmB CcmC D CcmG CcmF ... absence of a gene for an exogenous cytochrome System II can mature monoheme c- type cytochromes in E coli Cytochrome c5 50 from Paracoccus denitrificans is well characterized as a heterologous holocytochrome ... spectra of periplasmic extracts from E coli EC06 cells expressing H pylori ResBC and P denitrificans cytochrome c5 50 (broken-dotted line), cytochrome c5 50 AXXAH variant (full line) and no cytochrome...
Ngày tải lên: 06/03/2014, 09:22
.THE HISTORY OF AUSTRALIA AND NEW ZEALAND FROM 1606 TO 1890 docx
... success He examined the country for a few miles inland, and two of his scientific friends—Sir Joseph Banks and Dr Solander—made splendid collections of botanical specimens From this circumstance ... that, if they became convicts, they had a fair chance of growing rich and prosperous Accordingly, they entered a shop and stole a piece of cloth They were tried, convicted, and sentenced to be transported ... circumstance the place was called Botany Bay, and its two headlands received the names of Cape Banks and Cape Solander It was here that Captain Cook, amid the firing of cannons and volleys of musketry,...
Ngày tải lên: 06/03/2014, 12:21
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... 5¢-CACGATGATGGATGAAATGGCG TC-3¢ For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢ Cycling conditions were 94 C for min, followed by 35 cycles of 94 C for ... from first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢ ... Fermentas) and 10 lm of each of the following primers For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as different localizations of the receptor constructs before and after activation may also contribute ... Faussner et al Role of helix and C- termini in bradykinin receptors Fig Schematic representation of the C- terminal B1wt and B2wt sequences and chimera thereof The C- terminal sequences beginning at ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler...
Ngày tải lên: 07/03/2014, 16:20