... implementation of such an approach has limitations in that it requires a substantial (and continuing) investment in quality control, training and access to a central facility The validity and reliability of ... health care system, social environment, hospital settings and culture to be similar enough that it is acceptable to pool data in Scandinavia Admission data from the nine participating Scandinavian ... Claesson and Svensson [36] used the rank-invariant statistical method and suggested a scale reduced to four categories, as did also Heinemann and coworkers using Rasch analysis RSM [37] Thus, a reduction...
Ngày tải lên: 20/06/2014, 15:20
... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork...
Ngày tải lên: 15/03/2014, 21:20
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... audience analysis, organization, stage fright, visual aids, eye contact and facial expressions, body language, voice, Q &A period, and language use in presentation Students can all know these factors ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar...
Ngày tải lên: 19/03/2015, 10:37
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... the data analysis and interpretation, and also participated in writing the manuscript All authors read and approved the final manuscript References It is important to note that this type of analysis ... mechanism for establishing and correcting for bias under such circumstances This bias does not necessarily manifest though the ANOVA distributional analysis, and raises important issues about ... Quality of Life Scale Rheumatol Int 2003, 23:21-26 Küçükdeveci AA, Sahin H, Ataman S, Griffiths B, Tennant A: Issues in cross-cultural validity: Example from the adaptation, reliability and validity...
Ngày tải lên: 20/06/2014, 15:20
báo cáo khoa học:" Lack of association between celiac disease and dental enamel hypoplasia in a case-control study from an Italian central region" pdf
... Sangianantoni A, D'Angio F, Santarelli A, Lo Muzio L: Oral aphthous ulcers and dental enamel defects in children with coeliac disease Acta Paediatr 2006, 95(2):203-207 Majorana A, Sapelli PL, Malagoli ... N, Malhotra V: Adult celiac disease in northern India Indian J Gastroenterol 2003, 22(4):124-126 Lahteenoja H, Toivanen A, Viander M, Maki M, Irjala K, Raiha I, Syrjanen S: Oral mucosal changes ... Meini A, Pillan MN, Plebani A, Ugazio AG, Majorana A, Sapelli PL: High prevalence of DRW10 and DQW1 antigens in celiac disease associated with recurrent aphthous stomatitis Am J Gastroenterol...
Ngày tải lên: 11/08/2014, 23:22
three extensions to the inventory theoretic approach- a transportation selection model, a discrete event simulation of the inventory theoretic approach, postponement from an inventory theoretic perspective
... Speed and reliability are modeled by the mean and standard deviation of door-to-door transit time for all available transportation options, and each speed and reliability combination has a corresponding ... constraints are easily added or changed, and they guarantee the optimal answer given valid assumptions and accurate data Hence, additional constraints and other considerations can be added to the ... problematic (the matrix approach) Conversely, optimization models can handle a wide variety of variables, easily accommodate additional constraints, and guarantee the optimal answer given valid assumptions...
Ngày tải lên: 02/11/2014, 00:50
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... reasonable skill and care - a standard reasonably expected of a practitioner with an equivalent level of training and experience [9] A practitioner is expected to have the relevant qualifications and ... the Tort Law Reform and enactments of the Civil Liability Acts (or its equivalents) in most Australian states between 2002 and 2003, the standard of care is taken to be a standard that conforms ... themselves out as having special skills, may be required to meet the standard of a doctor with those special skills or a higher standard than the ordinary Huang and McLean Critical Care 2010, 14:313...
Ngày tải lên: 25/10/2012, 10:02
Tài liệu Pass a Dataset Back from an XML Web Service docx
... windows Form Create a new Windows Form and place the controls shown in Table 13.2 in the order displayed in Figure 13.14 Table 13.2 Label, TextBox, DataGrid, and Command Button Control Property ... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... - - - ...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... b-1,4-endogalactanase production using azo-galactan Transformant NW290::pIM3982.77 was selected as the highest b-1,4-endogalactanase producing transformant and was used for the purification of GALA Growth ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A (B) Change over time in the chromatographic peak area of cleavage fragments Note that the amount of fragments A1 , A2 and A4 decreases...
Ngày tải lên: 23/03/2014, 09:20
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... we mean by management? [8] Chapter The classical definition of management, as also found on Wikipedia, is as follows: Management in all business areas and organizational activities are the acts ... implemented and work with other departments or teams to participate or facilitate A manager acts as an entrepreneur to design and create a change in the organization For example: • Create innovations...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx
... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... suggesting that behaved as a substrate rather than an inhibitor At the same time, this shows that the peptide bond between Lys19 and Ser20 (the reactive site) and the Arg16Abu17 bond are both rapidly ... splicing A Łegowska et al ˛ A B Fig MS spectra and results of HPLC analysis of (A) [FK]BiSFTI-1 (8) and (B) a mixture of b-trypsin and [FK]BiSFTI-1: peak 2, analogue without tripeptide Abu-Thr-Lys;...
Ngày tải lên: 29/03/2014, 09:20
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... largely exceeding the oceanic subsurface warming duration, translating in a second peak in sea level rise rate and an extended plateau of ice discharge after the main peak (see purple and gray...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding to five codons encoding an enterokinase ... they are equally potent for cardiac and neuronal Na+ channels [39] Pharmacological activity of recombinant BmKIM Injected into larvae, rBmKIM caused a slow, progressive depressant flaccid paralysis...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc
... transcripts in CNS, liver and gonads as well as in larval tissue, but not in muscle tissue (Fig 4A) Total RNA from a shark, Squalus acanthias, liver was run in parallel as a negative control Controls ... putative transmembrane regions, a cysteine pair linking extracellular loop and loop 2, and a cysteine in the C-terminal tail where palmitoylation could serve as an anchor to the membrane and ... using a linear gradient Absorbance was measured at 214 and 280 nm and the major peak in the chromatogram was collected by hand The identity of the peptides was confirmed by automated Edman degradation...
Ngày tải lên: 31/03/2014, 23:20
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses
... Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path ... organizations or companies join together to become a new business • In an acquisition: one business buys a second and generally smaller company Goals Increase in top line revenue Expand in a declining ... manage contractual relationships Affect on product quality or firm’s costs Growths • Be considered vital to the health of company • Be a mean of survival • Be encouraged mergers growth by tax...
Ngày tải lên: 08/05/2014, 17:42
báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx
... collection, analysed the data, and wrote successive drafts of the manuscript Katharina Kober participated in the design of the study, participated in data collection and data analysis, and reviewed ... of care, but also at the level of care teams, health care facilities, and support systems These different layers of learning and adaptation can potentially have a multiplication effect, and may ... D, Hildebrand K, Boulle A, Maartens G, Louis F, Labatala V, Reuter H, Ntwana N, Goemaere E: Outcomes after two years of providing antiretroviral treatment in Khayelitsha, South Africa AIDS 2004,...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Network-based social capital and capacity-building programs: an example from Ethiopia" pdf
... Press: Cambridge England; 2005:98-116 37 Kawachi I, Subramanian SV, Kim D: Social Capital and Health: A Decade of Progress and Beyond in Social Capital and Health Edited by: Kawachi I, Subramanian ... changing approaches to hospital management, and thus presented an environment in which social capital exchange was warranted and could have impact Network development and social capital exchange may ... the data analysis and drafted the manuscript EHB, SK, and JM provided intellectual content and manuscript revisions All authors read and approved the final manuscript Acknowledgements The authors...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx
... copper amalgam? In what year did all your use of copper amalgam end* Have you worked with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and ... Chicago, IL, USA) The concordance between participants who had worked in the same clinic regarding the years the participants started and ended the use of copper amalgam and Dentomat was analyzed ... was deemed to be in accord with the Helsinki declaration on medical research ethics Statistical analysis Data were registered and analyzed with the data program Statistical Package for Social...
Ngày tải lên: 20/06/2014, 00:20