figure 3 examples of nanocarriers for targeting cancer a a whole range of delivery agents are possible but the main components typically include a nanocarrier a targeting moiety conjugated to the nanocarrier and a cargo such as the desired chemotherap
Báo cáo khoa học: "Consequential late effects after radiotherapy for prostate cancer - a prospective longitudinal quality of life study" pps
Ngày tải lên :
09/08/2014, 08:23
... decline in the acute phase [22], whereas the hormonal domain cannot be regarded as a domain with major effects from the local radiotherapy treatment Statistical analysis was performed using the SPSS ... can lead to a relevant severity and duration of acute radiation effects The intestinal or bladder mucosa is damaged to a considerable degree, so that an adequate barrier against mechanical and/ or ... capacity of the bladder wall or urethra are more likely to have a reduced repair capacity of the rectal wall and vice versa The results of this study emphasize the need of close follow-up and early...
- 9
- 303
- 0
Báo cáo khoa học: "Proposing the lymphatic target volume for elective radiation therapy for pancreatic cancer: a pooled analysis of clinical evidence" ppsx
Ngày tải lên :
09/08/2014, 08:23
... body/tail cancer: Area pre-aor 13%, Area inter 13%), while other areas including those posterior and lateral to the aorta and the vena cava and those anterior to the vena cava had
- 13
- 310
- 0
Báo cáo khoa học: " Dosimetric comparison of intensity-modulated, conformal, and four-field pelvic radiotherapy boost plans for gynecologic cancer: a retrospective planning study" ppsx
Ngày tải lên :
09/08/2014, 10:20
... participated in the conception and design of the study as well as collection and analysis of the data AF participated in the conception, analysis and interpretation of the data as well as drafting ... average 21% (range 1–56%) of the rectal volume was encompassed by the PTV, as was 13% (range 4–35%) of the bladder volume The remaining small and large bowel was contoured from the level of the ... drafting of the manuscript MM participated in the conception and design of the study as well as the analysis, interpretation of the data and drafting the manuscript All authors read and approved the...
- 10
- 201
- 0
Báo cáo y học: "Osteoradionecrosis of the cervical spine presenting with quadriplegia in a patient previously treated with radiotherapy for laryngeal cancer: a case report" docx
Ngày tải lên :
11/08/2014, 17:21
... deficit at this time, and he was treated with analgesics He was admitted as an emergency months later with increasing pain in his neck and, in addition, pain and paraesthesia in his right arm A further ... precautions, there is a risk of radiation injury to soft tissue and bone There are a plethora of literature/papers describing avascular necrosis to structures, such as the mandible, the temporal bones, the ... and carried out a review of the literature RT conceived the study, and participated in its design and coordination and all of the authors helped to draft the manuscript All authors read and approved...
- 4
- 208
- 0
Báo cáo y học: "Pancreatic and psoas abscesses as a late complication of intravesical administration of bacillus Calmette-Guerin for bladder cancer: a case report and review of the literature" ppt
Ngày tải lên :
11/08/2014, 17:21
... cystoprostatectomy years earlier and had also had an endovascular stent-graft repair of an infrarenal abdominal aortic aneurysm The patient complained of abdominal pain in his right flank A physical ... physical examination revealed general poor health but pulmonary and cardiac examinations were unremarkable and the patient was afebrile Laboratory investigations were normal with the exception of anemia, ... that has been used to treat urothelial carcinoma since 1976 and has been reported to eradicate disease in more than 70% of patients with in situ and stage I disease [1] Although intravesical therapy...
- 4
- 273
- 0
The Management of Community-Acquired Pneumonia in Infants and Children Older Than 3 Months of Age: Clinical Practice Guidelines by the Pediatric Infectious Diseases Society and the Infectious Diseases Society of America pot
Ngày tải lên :
28/03/2014, 09:20
... to all influenza B strains The WHO and CDC track and report resistance as strains are analyzed during the influenza season Dosages of antiviral agents that are currently recommended for seasonal ... of oral antimicrobial therapy before discharge is important, particularly for agents such as liquid clindamycin, which is known to have an unpalatable taste Ways to improve the palatability of ... had a total lung capacity $1 standard deviation below the mean for age; of these patients was considered to have mild restrictive lung disease (defined as a total lung capacity $2 standard deviations...
- 52
- 839
- 1
báo cáo khoa học: "Inflammatory myopathy and severe rhabdomyolysis induced by leuprolide acetate therapy for prostate cancer: a case report" pot
Ngày tải lên :
10/08/2014, 23:20
... polymyositis and scleroderma [8-10] Although cancer- associated myopathy can be of inflammatory origin [11], we assume that a paraneoplastic etiology of the myositis in our patient is not probable Page of ... http://www.jmedicalcasereports.com/content/5/1/409 Page of and supervised the writing of the case report All authors were involved with the treatment of the patient, and all authors read and approved the final ... his serum PSA and the fact that the size of the solitary node in his lung decreased during leuprolide acetate therapy, we assume that prostate cancer therapy was successful in our patient We consider...
- 4
- 374
- 1
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
Ngày tải lên :
30/03/2014, 04:20
... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... maturation are the molecular basis of the decreased rate of PtdSer decarboxylation in oxa1D mitochondria One obvious explanation for the decreased amount of Psd1p in oxa1D mitochondria was a possible...
- 11
- 354
- 0
Báo cáo hóa học: " The Effect of Single, Binary and Ternary Anions of Chloride, Carbonate and Phosphate on the Release of 2,4-Dichlorophenoxyacetate Intercalated into the Zn–Al-layered Double Hydroxide Nanohybrid" pot
Ngày tải lên :
22/06/2014, 00:20
... from the nanohybrid into the release media was accomplished using various aqueous solutions: chloride, carbonate and phosphate and the combination of them by adding about 0.34 g of ZANDI into a ... Characterizations of the Sample Figure shows PXRD patterns of ZAN and its nanohybrid ZANDI As shown in the figure, the basal spacing of ZAN, which contains nitrate as the counter anion in the interlayer ... ZAN the parent material and 2,4-D the guest anion For ZANDI, a band at 3,438 cm-1 corresponds to the OH internal hydrogen bond, while a band at 1,614 cm-1 corresponds to the carboxylate ion and...
- 7
- 459
- 0
Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx
Ngày tải lên :
09/08/2014, 01:24
... a pore size of 0.2 µm (Dynagard; Spectrum Laboratories, CA, USA), aliquoted and stored at – 70°C until use The amount of endotoxin in the antibody solutions prepared was found to be in the range ... have a different effect on the acute phase of arthritis However, T cells again did not affect the initiation phase of the disease; instead, the effect was noted in the more chronic phase of the ... hydroxylated rat CII (rHyK), denatured rat CII (dCII) and mouse and rat galactosylated CII (mGalHyK and rGalHyK, respectively) peptides were used Rat CII was heat denatured at 50°C for 20 Results are...
- 7
- 434
- 1
Single and dual task tests of gait speed are equivalent in the prediction of falls in older people a systematic review and meta analysis
Ngày tải lên :
25/08/2016, 23:09
... JMB_3 ABAY1RSABA_P1ABA+k ABAG1RSABA8P1AB8Ak AB8+1RSABJAP1AB+Jk SABA_1RSABYYP1AB8+k AB 8A1 RSABA3P1ABY3k SABA31RSABY3P1AB8Yk SABAJ1RSABY8P1AB8_k AB8_1RABAAP1ABYKk ABA31RSABAGP1ABY8k ABAM1RSABA_P1ABY8k ... SABAK1RSABYJP1AB8_k AB8J1RSABA3P1AB_Kk ABA_1RSAB8MP1ABYGk SABAY1RSABY8P1AB83k AB881RABAAP1ABYYk ABAJ1RSABA3P1AB8+k ABAK1RSABAGP1AB8+k ABA+1RSABA+P1ABY8k AB8G1RABA8P1AB_Ak ABAM1RSABAGP1ABY_k AB8+1RABAKP1ABY3k ... ABAM1RSABA_P1ABY8k ABAM1RSABAKP1ABYJk AB831RABA_P1AB_Yk ABAM1RSABAGP1ABY_k ABYA1RABAKP1AB_Jk AB8Y1RSABAGP1ABYMk AB8_1RABAJP1ABYYk AB8+1RABAYP1AB_Yk AB8M1RABA+P1AB_8k ABAM1RABAGP1AB8Yk 8AB+_ MBJG AB8_ 8BA3 8B_J...
- 53
- 371
- 0
Báo cáo khoa học: " Absence of toxicity with hypofractionated 3-dimensional radiation therapy for inoperable, early stage non-small cell lung cancer" pot
Ngày tải lên :
09/08/2014, 10:21
... regional + distant and distant only Actuarial and 2year overall survival rates are 78% and 56%, cancer specific survival rates (CSS) are 90% and 74% (Figure 3), and local relapse free survival rates ... Hypofractionation may result in an increase of normal tissue effects and a careful evaluation of acute and late toxicity is essential The current challenge is to find the best balance between an ... early stage nonsmall cell lung cancer (NSCLC) who are not surgical candidates Although primarily appealing for patients with tumors that are rapidly proliferating such as NSCLC because of a possible...
- 6
- 391
- 0
BT 3 optimization of medium for indole 3 acetic acid production using pantoea agglomerans strain PVM
Ngày tải lên :
06/08/2013, 21:06
... Biosynthesis of indole-3-acetic acid O .A Apine and J.P Jadhav Pantoea agglomerans is wide spread in many diverse natural and agricultural habitats, in particular it is associated with many plants as ... conditions up to 168 h Production of IAA and residual l-tryptophan was measured at every after 24 h IAA and L-tryptophan assay The IAA produced was assayed by previously quoted method (Gordon and Weber ... interval after each stroke After sonication, the homogenate was centrifuged at 14 000 g for 10 min, and the supernatant was used as a crude enzyme source Assay The tryptophan aminotransferase activity...
- 10
- 543
- 1
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
Ngày tải lên :
19/02/2014, 07:20
... (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL ... for GAA and AGA mutants were prepared using a plasmid encoding GGA as a template and primers that anneal to nucleotide numbers 277–314 of psToc75 Plasmids carrying sequences encoding AGG and GAG ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75, and mToc75 with the...
- 9
- 496
- 0
Tài liệu Examples of the Standards for Students’ Writing 2009: English Language Arts Grade 9 ppt
Ngày tải lên :
24/02/2014, 18:20
... be formatted in the same way as the main address For more information, refer to the “Addressing Guidelines” in the Canada Postal Guide on the Canada Post website at canadapost.ca Format of a Business ... detail to fulfill the purpose of the assignment • A tone appropriate for the addressee is generally maintained • The ideas are superficial and/ or flawed, and development of the topic is inadequate ... ideas and forms that the student has considered Examination markers and staff at Alberta Education take plagiarism and cheating seriously Introduction t is essential that each of these examples...
- 49
- 834
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
Ngày tải lên :
06/03/2014, 01:20
... 200-2005-13434, TO# 16, between the National Academy of Sciences and the Department of Health and Human Services and by the Task Force for Child Survival and Development on behalf of the National Viral Hepatitis ... surveillance data APPLICATIONS OF SURVEILLANCE DATA Surveillance data are used in a variety of ways by a broad base of state health-department staff, researchers, clinicians, policy-makers, and private ... control of infectious and chronic diseases and the medical management of people who have the diseases Surveillance data are used to estimate the magnitude of a health problem, to describe the natural...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
Ngày tải lên :
06/03/2014, 01:20
... states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates ... pervasive lack of knowledge about hepatitis B among Asians and Pacific Islanders, and this is probably also the case for other foreign-born people in the United States The lack of awareness in foreign-born ... and Quality acquired immunodeficiency syndrome alanine aminotransferase Hepatitis B core antibody Hepatitis B surface antibody Hepatitis C antibody Asian and Pacific Islander aspartate transaminase...
- 253
- 369
- 0
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx
Ngày tải lên :
06/03/2014, 02:21
... the methylenetetrahydrofolate reductase and the methionine synthase genes which increase the relative amount of folate available for DNA synthesis and repair also reduces the risk of colon cancer ... effects for women undergoing radiation therapy for carcinomas of the uterine cervix [175], for patients undergoing radiation therapy for head and neck cancers [176], and for colorectal cancer patients ... to a green powder from the juice of barley leaves and alfalfa that is equivalent to approximately another 100 g/day of fresh dark greens So, it is very possible that the range of intakes in the...
- 21
- 740
- 0
Overview of Trastuzumab’s Utility for Gastric Cancer pdf
Ngày tải lên :
06/03/2014, 02:21
... rates were 35% and stable disease was 17% The therapy was well tolerated and no grade toxicities were seen The first randomized, controlled phase III trial, (ToGA) evaluated trastuzumab efficacy ... clinical practice For them, chemotherapy has been considered standard with significant advantages (increased survival, symptom control and quality of life) compared to BSC alone Trastuzumab is the ... fibroblast growth factor, c-Met and downstream signaling inhibitors, as well as cell cycle associated drugs targets are also under evaluation in phase I and II studies with advanced GC patients...
- 6
- 474
- 0