fermi level for a single molecule

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... Silicon-nitride cantilevers (Veeco, Santa Barbara, CA) were calibrated for their spring constant using the equipartition theorem The average spring constant was ~ 15 pN nmÀ1 for forceclamp experiments and ... and the last amino acid of strand G (K87) This distance, x(Y9)ÀxACHTUNGRE(K87), increases as the two b-strands separate under a constant force filling the gap with D2O molecules until the transition ... trace with a characteristic sawtooth pattern appearance Figure A shows a typical force extension trace for unfolding the protein I27 in D2O Figure C shows a histogram of peak unfolding forces, Funfold...

Ngày tải lên: 22/03/2014, 18:20

12 554 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

... elasticity as a Magnetic traps Magnetic traps operate similarly to optical traps in that they allow free maneuvering of a bead in solution Just as a particle is trapped in a potential well created ... stretched at pH 8.0 on a poly(methylmethacrylate)-coated surface, measured by a ‘‘photocleavage assay.’’ Each pair of images shows a T7 DNA molecule before (left) and after (right) the photocleavage ... mechanical force exerted on the bead DNA molecules can then be manipulated by holding in an optical trap a polystyrene bead that is attached to one end of a DNA molecule and then stretching the molecule...

Ngày tải lên: 22/06/2014, 18:20

17 351 0
Tài liệu A neural-network-based space-vector PWM controller for a three-level voltage-fed inverter induction motor drive doc

Tài liệu A neural-network-based space-vector PWM controller for a three-level voltage-fed inverter induction motor drive doc

... signals are compared with the output of a single UP/DOWN counter and processed through a logic block to generate the PWM outputs for for for for for (5) for for for for for for for for for for ... -phase P states and performed with the and signals only Similar operations are signals of all the phases and all the The drive performance was evaluated in detail by simulation with the neural ... states appear as notched waves (see Fig 4) On the other hand, in , or states appear as notched waves the even sector states appear as pulsed waves This can be easily veriand fied by drawing waveforms...

Ngày tải lên: 22/12/2013, 08:16

10 522 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... molecular mass distribution on SDS ⁄ PAGE Using the respective specific Abs, glycanated PGs migrate as follows: SD-4 as a 100–250 kDa broad smear, SD-1 as a single 98 kDa band, CD44 as a 110 kDa band,...

Ngày tải lên: 16/03/2014, 18:20

15 423 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx

Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx

... well-known argument for deflation as a means for achieving an 'optimum quantity of money' is distinct from earlier arguments for falling prices As we shall see, it actually calls for deflation at a rate ... help achieve a full-information ideal for resource allocation, my argument also contradicts the claim that a variable inflation rate is the worst kind as well as the claim that an uncertain price ... bias inherent in available data The BLS estimates may, t.herefore, be about right after all For a comparison of alternative measurements of total factor productivity see Bureau of Labor Stat.istics,...

Ngày tải lên: 29/03/2014, 12:20

83 323 0
Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx

Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx

... to achieve full adaptivity to the clutter, generally the radar system has to undergo a multiple -A/ D (hardware) upgrade where a number of sampled data streams are made available However, for practical ... variance and E{·} denotes the expectation operator The usual assumptions such as patchto-patch statistical independence (zero-mean Gaussian) are made on the clutter as well as target The data ... extensive simulation Another observation based on simulation data as well as MCARM data is that the order of pattern ratio is best to be around half the total number of sensors in the array In our...

Ngày tải lên: 21/06/2014, 08:20

14 342 0
báo cáo hóa học:" Research Article Ishikawa Iterative Process for a Pair of Single-valued and Multivalued Nonexpansive Mappings in Banach Spaces" doc

báo cáo hóa học:" Research Article Ishikawa Iterative Process for a Pair of Single-valued and Multivalued Nonexpansive Mappings in Banach Spaces" doc

... the American Mathematical Society, vol 44, pp 147–150, 1974 K P R Sastry and G V R Babu, “Convergence of Ishikawa iterates for a multi-valued mapping with a fixed point,” Czechoslovak Mathematical ... Y Song and H Wang, “Erratum to: “Mann and Ishikawa iterative processes for multivalued mappings in Banach spaces” Comput Math Appl 54 2007 872–877 ,” Computers & Mathematics with Applications, ... Mathematical Journal, vol 55 130 , no 4, pp 817–826, 2005 B Panyanak, “Mann and Ishikawa iterative processes for multivalued mappings in Banach spaces,” Computers & Mathematics with Applications, vol...

Ngày tải lên: 21/06/2014, 11:20

9 324 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt

Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt

... Grazer Mathematische Berichte, pp 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation ... 37 R P Agarwal, B Xu, and W Zhang, “Stability of functional equations in single variable,” Journal of Mathematical Analysis and Applications, vol 288, no 2, pp 852–869, 2003 38 M Kuczma, B Choczewski, ... equations,” a Carpathian Journal of Mathematics, vol 23, no 1-2, pp 63–72, 2007 35 Z Wang, X Chen, and B Xu, “Generalization of functional equation for the square root spiral,” Applied Mathematics...

Ngày tải lên: 22/06/2014, 06:20

15 363 0
Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx

... length f has to be assumed known, which is not always available for the uncontrollable test image We take the advantage that the facial features on the frontal view mean face are available, and show ... 3D face scans For a test image at a rotated pose and under an arbitrary illumination condition, we manually establish the image correspondence between the test image and a mean face image at the ... Jacobs, “Appearance characterization of linear lambertian objects, generalized photometric stereo, and illumination-invariant face recognition,” IEEE Transactions on Pattern Analysis and Machine...

Ngày tải lên: 22/06/2014, 19:20

18 354 0
Báo cáo hóa học: "ON RANDOM COINCIDENCE AND FIXED POINTS FOR A PAIR OF MULTIVALUED AND SINGLE-VALUED MAPPINGS" pot

Báo cáo hóa học: "ON RANDOM COINCIDENCE AND FIXED POINTS FOR A PAIR OF MULTIVALUED AND SINGLE-VALUED MAPPINGS" pot

... will mean Σ-measurability A mapping f : Ω × X → X is called a random operator if for any x ∈ X, f (·,x) is measurable A mapping T : Ω × X → CB(X) is called a multivalued random operator if for every ... measurable A mapping s : Ω → X is called a measurable selector of a measurable multifunction T : Ω → 2X if s is measurable and s(ω) ∈ T(ω) for all ω ∈ Ω A measurable mapping ξ : Ω → X is called ... International Journal of Mathematics and Mathematical Sciences (1984), no 3, 429– 434 [17] R T Rockafellar, Measurable dependence of convex sets and functions on parameters, Journal of Mathematical...

Ngày tải lên: 22/06/2014, 22:20

12 279 0
Báo cáo sinh học: " Combined single-molecule force and fluorescence measurements for biology" ppt

Báo cáo sinh học: " Combined single-molecule force and fluorescence measurements for biology" ppt

... Ishijima A, Kojima H, Funatsu T, Tokunaga M, Higuchi H, Tanaka H, Yanagida T: Simultaneous observation of individual ATPase and mechanical events by a single myosin molecule during interaction ... interaction with actin Cell 1998, 92:161-171 30 Harada Y, Funatsu T, Murakami K, Nonoyama Y, Ishihama A, Yanagida T: Single- molecule imaging of RNA polymeraseDNA interactions in real time Biophys ... combined single- molecule force and fluorescence measurements can probe biomolecular interactions (a) An optical trap; (b) dual optical traps; (c) an atomic force microscope (AFM) Labeling of a biomolecule,...

Ngày tải lên: 06/08/2014, 18:20

5 255 0
Báo cáo khoa học: " RadioImmunotherapy for adenoid cystic carcinoma: a single-institution series of combined treatment with cetuximab" docx

Báo cáo khoa học: " RadioImmunotherapy for adenoid cystic carcinoma: a single-institution series of combined treatment with cetuximab" docx

... pts Table patient characteristics patient characteristics median age [40 - 77] Epipharynx pts Fossa pterygopalatina pts Maxilla pt tuba auditiva tumour stage pts base of skull Analysis Treatment ... EK, Ang KK: Radiotherapy plus cetuximab for locoregionally advanced head and neck cancer: 5-year survival data from a phase randomised trial, and relation between cetuximab-induced rash and survival ... neoplasms with fast neutron radiotherapy Arch Otolaryngol Head Neck Surg 2003, 129(9):944-8 Mizoe JE, Tsujii H, Kamada T, Matsuoka Y, Tsuji H, Osaka Y, Hasegawa A, Yamamoto N, Ebihara S, Konno A: ...

Ngày tải lên: 09/08/2014, 09:20

8 340 0
Báo cáo khoa học: "Intraoperative radiation therapy for advanced cervical metastasis: a single institution experience." pot

Báo cáo khoa học: "Intraoperative radiation therapy for advanced cervical metastasis: a single institution experience." pot

... in statistical analysis DW, SF, EK and RB contributed to discussion and data analysis TH participated in data analysis and manuscript writing All the authors read and approved the final manuscript ... head and neck surgeon and the radiation oncologist Despite advances in surgical and radiation techniques, survival rates in for patients with advanced cervical metastasis remains low From a radiobiology ... Hospital, Indianapolis, IN, USA Authors’ contributions YHZ analyzed the data and wrote the manuscript He is the corresponding author AY reviewed the manuscript and the data analysis CT participated...

Ngày tải lên: 09/08/2014, 09:20

7 221 0
Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx

Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx

... female/1 Male/2 Female/11 Female/9 Female/12 Male/2 Male/9 Female/12 Female/3 female/16 RMSE Synovial sarcoma ASPS Synovial sarcoma Synovial sarcoma ASPS RMSE ASPS ASPS fibrosarcoma Synovia sarcomal ... sarcoma (STS) These include external beam irradiation (EBRT), brachytherapy (BRT), and intraoperative radiation therapy Unfortunately, EBRT can cause growth retardation or adversely affect organ ... (2/10) avitary applicators and interstitial implants Intracavitary brachytherapy was done by the confection of special devices (moulds) of catheter located into the vagina, nasopharynx and urethra,...

Ngày tải lên: 09/08/2014, 09:22

6 260 0
Báo cáo y học: "Surgical treatment for pulmonary metastases from esophageal carcinoma after definitive chemoradiotherapy: Experience from a single institution" doc

Báo cáo y học: "Surgical treatment for pulmonary metastases from esophageal carcinoma after definitive chemoradiotherapy: Experience from a single institution" doc

... metastasis from esophageal carcinoma Interact Cardiovasc Thorac Surg 2008, 7:809-812 Shiono S, Kawamura M, Sato T, Nakagawa K, Nakajima J, Yoshino I, Ikeda N, Horio H, Akiyama H, Kobayashi K: Disease-free ... indicated that solitary pulmonary metastasis from esophageal carcinoma was a favorable indicator for surgical treatment [6] In this article, patients with solitary pulmonary metastasis also showed ... standard curative treatment for resectable esophageal cancer, definitive CRT has become a prevalent alternative as a nonsurgical treatment for unresectable esophageal carcinoma or Patient A 68-year-old...

Ngày tải lên: 10/08/2014, 09:22

6 498 0
Báo cáo y học: "The International Documentation and Evaluation System IDES: a single center observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity" pdf

Báo cáo y học: "The International Documentation and Evaluation System IDES: a single center observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity" pdf

... between a minimal dataset (implant registry), a scientific dataset, and optional add-on subforms Moreover, the forms are available as scanable OMR (optical mark reader) forms and in an online ... to allow for real-time documentation at source in a team effort All IDES forms are usually avail- Figure IDES Ankle Primary Form (A) Page of able in English, German, French, Spanish and Italian ... subforms: - Admission - Admission add-on - Clinical evaluation (AOFAS ankle score) - Clinical evaluation add-on - Surgery - Surgery add-on - Radiology - Discharge The B-form has an additional...

Ngày tải lên: 10/08/2014, 21:24

8 316 0
báo cáo khoa học: "A homoharringtonine-based induction regimen for the treatment of elderly patients with acute myeloid leukemia: a single center experience from China" pptx

báo cáo khoa học: "A homoharringtonine-based induction regimen for the treatment of elderly patients with acute myeloid leukemia: a single center experience from China" pptx

... CR as the following: HA regimen as described above, DA (DNR, 30 mg/m2 daily for days, Ara-C 100 mg/m2 daily for days) or IDA (idarubicin, mg/m2 daily for days, Ara-C 100 mg/m2 daily for days), ... days), EA (etoposide, 60 mg/m2 daily for days, Ara-C 100 mg/m2 daily for days) and MA (mitoxantrone mg/ m2 daily for days, Ara-C 100 mg/m2 daily for days) by turns In patients older than 70 years, ... Coso D, Bardou VJ, Stoppa AM, Braud AC, Bouabdallah R, Sainty D, Mozziconacci MJ, Lafage M, Damaj G, Blaise D, Gastaut JA, Maraninchi D: The benefit of induction chemotherapy in patients age > or...

Ngày tải lên: 10/08/2014, 22:20

5 349 0
Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

... secure the validity of small percentages and/ or differences Results following FACS analysis were Data analysis The analyses for safety and tolerability parameters were performed on all randomised ... study, was involved in data analysis and in the drafting of the manuscript CG performed immunoassays, data acquisition and analysis MM carried out blood cells isolation and stimulation GP was involved ... expected for a therapeutic vaccine adjuvant Future clinical studies are underway to assess the potential of such non-inflammatory non-TLR ligands used alone or as adjuvants for therapeutic vaccines...

Ngày tải lên: 11/08/2014, 10:23

15 330 0
báo cáo khoa học: "A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity" docx

báo cáo khoa học: "A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity" docx

... CCCACAATATAAGCCCAAGC 126 NtANS EB427369 F: TCCATCTGGCCTAAAATCCCT R: AACGCCAAGTGCTAGTTCTGG 226 NtDFR EF421429 F: CGCGTCCCATCATGCTATC R: AATACACCACGGACAAGTCC 116 NtUbiquitin NTU66264 F: GAAAGAGTCAACCCGTCACC ... (Stratagene) using the following primers pairs: F, 5’AGATCCTAATACGACTCACTATAGGGAGCCACCATGAGGAATGCATCCTCAGCA and R, 5’-(T)32TCAGAACCGCTTATCAGGTTG The PCR products were used as template A μl aliquot ... Hatanaka H, Nagadoi A, Enari M, Nakamura H, Nishimura Y, Ishii S, Sarai A: The cavity in the hydrophobic core of Myb DNAbinding domain is reserved for DNA recognition and trans-activation Nat...

Ngày tải lên: 11/08/2014, 11:21

14 383 0
w