faul in a car

... becoming rear admiral, had captained the football team and made one or two All-American squads at the Naval Academy in 1931, before surviving Pearl Harbor in 1941 and com- manding the ship—he later told ... in action—particularly Billy Cunningham, a 6'5" leaper from Brooklyn already becoming known as the Kangaroo Kid, and Jay Neary, a slick guard also from New York. Cunningham and Neary—as ... for himself in the days when teams such as Trinity and Van- derbilt and Sewanee held their own with Georgia and Alabama and Tennessee, when Duke went to the Rose Bowl after hiring away Alabama’s famous...

Ngày tải lên: 08/03/2014, 16:20

... glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial Gisela Del Carmen De La Rosa 1 , Jorge Hernando Donado 2 , Alvaro ... Alvaro Mauricio Quintero 3 , Luis Gabriel González 3 , Nora Elena Saldarriaga 4 , Marisol Bedoya 1 , Juan Manuel Toro 5 , Jorge Byron Velásquez 4 , Juan Carlos Valencia 4 , Clara Maria Arango 5 , ... Arango 5 , Pablo Henrique Aleman 1 , Esdras Martin Vasquez 4 , Juan Carlos Chavarriaga 4 , Andrés Yepes 4 , William Pulido 4 , Carlos Alberto Cadavid 1 and Grupo de Investigacion en Cuidado intensivo:...

Ngày tải lên: 25/10/2012, 10:35

... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12]. At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands ... 22:1335-1338. 9. Chahine-Malus N, Stewart T, Lapinsky SE, Marras T, Dancey D, Leung R, Mehta S: Utility of routine chest radiographs in a med- ical-surgical intensive care unit: a quality assurance survey. Crit ... [summarized in Table 1] were absent or present and, if an abnormality was present, whether it was judged to be an 'old' or 'new' finding). In case an abnormality was worsening,...

Ngày tải lên: 25/10/2012, 10:39

... quality assurance survey Natalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta Mehta Mount Sinai Hospital, Toronto, Ontario, Canada Correspondence: ... beneficial to patient care. Brainsky et al observed that 20% of routine CXRs performed in a medical ICU had ‘major important’ findings, and 8% prompted a change in management [4]. The majority of changes ... Gray et al found that clinicians were fairly accurate in determining the placement of subclavian or internal jugular (IJ) vein pulmonary artery (PA) catheter intro- ducer sheaths, but the clinicians...

Ngày tải lên: 25/10/2012, 10:45

... 3,4 , Tatsuya Okuno 3 , Naoko Chayahara 3 , Ikuya Miki 3 , Takao Tamura 3 , Tsubasa Inokuma 2 , Yoshiji Takemoto 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 ... M, Manda R, et al. Efficacy and toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y, ... et al. Evaluation of combined nedaplatin and docetaxel therapy for human head and neck cancer in vivo. Anticancer Res. 2006; 26: 989-94. 16. Yamashita H, Nakagawa K, Tago M, et al. Radiation...

Ngày tải lên: 26/10/2012, 09:53

Ngày tải lên: 05/09/2013, 08:40

... oocytes was counted (as in Dunlap-Pianka et al. 1977). Statistical analyses All statistical analyses were performed in JMP ver- sion 3.1 (SAS Institute, Cary, North Carolina, USA). Means are presented Ϯ 1 SE unless ... (Intake rate) ϫ␤ and mixes with a fractional turnover rate of [(Intake rate) ϫ␤ ]/ V. Carbon is lost from the mixing and nonmixing pools at the rate of (Egg laying rate) ϫ␣ and (Egg laying rate) ϫ (1 Ϫ␣ ), ... with AN- OVA, including sugar type, day, and the interaction between sugar and amino acids as effects. The decline in meal size over time was tested with linear regression. Nonparametric Spearman...

Ngày tải lên: 13/02/2014, 16:20

... Medical City, Riyadh, Saudi Arabia (Abdullah A. Alshimemeri, Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, and Othman Al Harbi) and Ministry of Health, Riyadh, Saudi Arabia (Ziad Memish) Address ... Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, Othman Al Harbi, Ziad Memish Crit Care & Shock (2011) 14:1-6 Abstract Objective: To examine the presentation and outcome of patients diagnosed ... percentages of groups where applicable. Variations within categories are shown as means with ranges where appropriate. Comparative data between characteristics are displayed, and data are summarized...

Ngày tải lên: 15/02/2014, 12:20

... regional telerehabilitation project; post-acute-care programs in regional hospitals; care- planning in rural areas utilising critical-pathway methodology; and community nursing clinical pathways ... degrees in applied science and theology, a master’s degree in theology, a graduate diploma in gerontic nursing, and a PhD. After a long and distinguished career in clinical and academic nursing, including ... holds a graduate diploma and a master’s degree in health science. Since 1994, she has worked as a project manager and acting operations manager at the Collaborative Health Education & Research...

Ngày tải lên: 16/02/2014, 22:20

... important to evaluate all aspects of your business concept and to continually balance your ideas against reality. After defining and refining your business idea, does it still look like a good ... business.  HARASSMENT: The government and the courts are taking a strong position in trying to discourage harassment in the workplace. Harassment, including sexual harassment, can take many ... is one that you obtain from a bank and pay back in monthly installments. A personal bank loan can either be secured (collateral is required as a guarantee that you will repay the loan) or unsecured...

Ngày tải lên: 18/02/2014, 00:20

... technical catalogue, etc.). Step 3 Arrange for shipment of the car to Singapore with a shipping agent. Step 4 Arrange with your shipping agent to obtain an Inward Cargo Clearance Permit. ... profile printout of the Club/Association/Organisation or other certificate issued by the relevant regulating authority and original NRIC (Singaporean, Singapore PR and Malaysian) or Passport ... i) Valid Inward Cargo Clearance Permit; and j) Original Purchase Invoice or Manufacturer/Factory Invoice. Pay the total of the following fees via Cashier’s Order, NETS or Cash: a) Processing...

Ngày tải lên: 07/03/2014, 11:20

... Manuals in a Monte-Carlo Framework S.R.K. Branavan David Silver * Regina Barzilay Computer Science and Artificial Intelligence Laboratory Massachusetts Institute of Technology {branavan, regina}@csail.mit.edu * ... built -in AI. 7 Results Game performance As shown in Table 1, our lan- guage aware Monte-Carlo algorithm substantially outperforms several baselines – on average winning 53.7% of all games within ... versa, in a cycle of continual improvement (Sutton and Barto, 1998). In many games, it is sufficient to maintain a dis- tinct action-value for each unique state and action in a large search tree....

Ngày tải lên: 07/03/2014, 22:20

... purification of the recombinant enzyme In order to c onstruct an expression vector for Cl -idh,two oligonucleotides (sense, 5¢ -A AAAA CATATGGCAAGCA AATCGACCATCATCTACAC-3¢, and antisense, 5¢-AAA AA GGATCCCGGCTGAAAACCGGGCTGCATTA-3¢) were ... sequences were obtained with the program ALIGN contained within the CLUSTALW program provided by DNA Data Bank of Japan (DDBJ). The sequence data was analyzed using GENETYX software package (Software Development, ... fumarate, m alate, glyoxylate, ATP, and ADP gave no significant effect on the carboxylation reaction (data not shown). H owever, considerable inhibition was observed when oxaloacetate was added into...

Ngày tải lên: 08/03/2014, 10:20

... Education Ministry of Education Antigua and Barbuda The Bahamas Barbados Barbados Belize Dominica Grenada Grenada Guyana Jamaica Joint British and Dutch overseas Territories (Anguilla) Joint ... the Bahamas, Barbados, Grenada, Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with one national sectoral plan including all education ... and HIV Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St. Kitts & Nevis St. Lucia St. Vincent & Grenadines Trinidad & Tobago Policy and Strategies ✓...

Ngày tải lên: 14/03/2014, 20:20

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTG MicroRNA-373 functions as an oncogene in ... TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma Nannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong and Hua...

Ngày tải lên: 14/03/2014, 23:20

... the backbone of tuberculosis (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints. The present study aimed to re-evaluate ... used as an aid in the diagnosis of mycobacterial disease for many years. It is the simplest procedure currently available to detect AFB in clinical samples by ZN staining. As seen in Table ... detection of AFB in sputum samples of patients with pulmonary tuberculosis in tertiary healthcare facilities which have a large number of cases and financial constraints. Ethical Approval The...

Ngày tải lên: 15/03/2014, 03:20

Ngày tải lên: 15/03/2014, 03:20

Ngày tải lên: 16/03/2014, 12:20

Ngày tải lên: 21/03/2014, 12:18

Ngày tải lên: 22/03/2014, 11:20