0

f9 causative genes of hemophilia a and hemophilia b

Báo cáo y học:

Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

Báo cáo khoa học

... CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT 3’]; TNF -a < /b> [antisense: 5’ AGA AGA GGC ACT CCC CCA AAA 3’; sense: 5’ CCG AAG TTC AGT AGA CAG AAG AGC G 3’]; MCP-1/CCL2 [sense: 5’ CAC TAT ... for Luc and < /b> b- Gal activities using a < /b> Promega Luc assay system and < /b> an ONPG (o-nitrophenyl -b- D-galactopyranoside)-based bGal assay b- Gal activity was used to normalize the Luc data for all experiments ... EMSA probes include: wildtype TNF -a < /b> B3 sense (5’-AACAGGGGGCTTTCC-3’) and < /b> antisense (5’AGGAGGGAAAGCCCC-3’), and < /b> mutant TNF -a < /b> B3 sense (5’-AACAGGGGGCTGAGCCTC-3’) and < /b> antisense (5’-GAGGCTCAGCCCCCTGTT-3’)...
  • 11
  • 622
  • 0
600 sentences of certificate A and B

600 sentences of certificate A and B

Cao đẳng - Đại học

... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of < /b> things are taken away a < /b> is b broken c off d away ... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over...
  • 280
  • 884
  • 3
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học

... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2, ... the averaged bimole6112 cular oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> ... ligands leaves the b subunits (Table 1, ) Using Eqns (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters...
  • 11
  • 577
  • 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học

... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... sequences available in the NCBI database The programs used are all available from http://www.infobiogen.fr Chromosome localization The Abo gene was first assigned to a < /b> rat chromosome using a < /b> panel of < /b> ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland,...
  • 8
  • 499
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Functional polymorphisms in genes of the Angiotensin and Serotonin systems and risk of hypertrophic " ppt

Hóa học - Dầu khí

... the Cardiology Departments of < /b> Hospital Universitario Central Asturias (HUCA) and < /b> Page of < /b> Hospital Universitario Valdecilla-Santander The existence of < /b> cardiac hypertrophy was suspected on the basis ... patients/controls and < /b> obtained the clinical and < /b> anthropometric data EC, MP, CG, MGC, BT, AIC, MD, BM, and < /b> VA performed all the genetic studies All the authors have read and < /b> approved the final ... intracellular signalling pathways Nat Rev Mol Cell Biol 2006, 7:589-600 Jaffré F, Bonnin P, Callebert J, Debbabi H, Setola V, Doly S, Monassier L, Mettauer B, Blaxall BC, Launay JM, Maroteaux L:...
  • 9
  • 537
  • 0
báo cáo hóa học:

báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot

Toán học

... possible link between the elevated serum levels of < /b> neurokinin A < /b> and < /b> anti-ribosomal P protein antibodies in children with autism Gehan A < /b> Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and < /b> Treatment ... Cairo, Egypt Corresponding Author: Gehan Ahmed Mostafa Address: Ahmed El-Samman Street off Makram Ebaid, Nasr City, Cairo, Egypt E-mail.: hafezg@softhome.net, gehan_mostafa@hotmail.com Abstract: ... Center, AL-Amodi Autism Research Chair, Department of < /b> Physiology, Faculty of < /b> Medicine, King Saud University, Riyadh, Saudi Arabia and < /b> 2Department of < /b> Pediatrics, Faculty of < /b> Medicine, Ain Shams University,...
  • 30
  • 522
  • 0
Báo cáo toán học:

Báo cáo toán học: "Parking functions of types A and B" ppsx

Báo cáo khoa học

... straightforward, but given a < /b> parking function, finding the associate factorization is not obvious The proof below gives an algorithm for associating a < /b> factorization to any parking function In particular ... leave the the electronic journal of < /b> combinatorics (2002), #N7 reader to check case by case Actually we can also make use of < /b> the further symmetry (1) which was absent in the type A < /b> case Let (a1< /b> ... exists among them some (b1 , , bn ) such that b1 = and < /b> (b2 , , bn ) is a < /b> nondecreasing parking function To see this, arrange the in increasing order, and < /b> consider m = max{ai −i | ≤ i ≤ n} and...
  • 5
  • 367
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " An immunohistochemical study of chromogranin A and Sp-1 immunoreactive cells in the gastrointestinal tract of ovariectomized rats" pdf

Báo cáo khoa học

... noituliD A < /b> ninargomorhc :AGC ,ninargomorhc 1-pS enivob :GCB ;stibbar ni desiar erew aresitna llA* ASU ,AC ,airetnipraC ,.proC OKAD ASU ,atosenniM ,retawllitS ,niroS aiD ecruoS sisylana lacitsitatS ... fo esac ni demrofrep saw )noitacifitnedi yravo( noitarepo mahs dna ,ytivac lanimodba eht ni seiravo htob gnivomer yb demrofrep saw ymotceiravo laretaliB noitarepo ot detcejbus dna noitanibmoc ... gruS J naisA noitapitsnoc cinorhc htiw stneitap ni seitilamronba llec enircodneoruen lasocuM Y adihsayaH ,T onayiM ,A < /b> akatamaY ,H ihsayaboK ,H atokoY ,A < /b> ihsayaboK 61 931-431 ,43 ,9991 ygolohtapotsiH...
  • 6
  • 349
  • 0
báo cáo khoa học:

báo cáo khoa học: " PR genes of apple: identification and expression in response to elicitors and inoculation with Erwinia amylovora" doc

Báo cáo khoa học

... ttgcactttgaaacaccacatc agcttattttgggcatcttcacc gtagttttgccccatatcacacca cttcacagtcaccatcttcaaca ggtgcaccagctttttcaa ggcaggcgcagttccaccag gacatgtctccggcgtatca caaaaacggcaatgaaggaacc ctggcgagctcatcatagaactgc agaccaccaagtactactgcac ... as a < /b> convenient marker of < /b> SAR [5] There is a < /b> plethora of < /b> information about SAR and < /b> PR genes < /b> related to several model plants, especially, Arabidopsis thaliana [2], and < /b> members of < /b> the Solanaceae ... when apple Table 3: Primers used for RT-PCR and < /b> probe synthesis Gene name Primer Sequence (5' → 3') PR- 1a < /b> gctcagccgtaatacaatcctctc tacccccactactgcacctcact gtttgctgcgcccattag ttgcactttgaaacaccacatc...
  • 12
  • 320
  • 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 1 4

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 1 4

Cao đẳng - Đại học

... concentrated by rotary evaporation The crude extract was partitioned between 1:2 (v/v) acetonitrile and < /b> hexanes and < /b> the acetonitrile layer was collected and < /b> dried via rotary evaporation to deliver a < /b> ... were washed with 10 mL of < /b> 5% NaHCO3, water and < /b> brine The organic layer was dried over Na2SO4 and < /b> the solvent was removed on a < /b> rotary evaporator After silica gel chromatography 18.0 mg of < /b> a < /b> yellow ... °C, and < /b> dried under vacuum to afford fractions A1< /b> A5 One fraction was obtained from each column Fractions A1< /b> -A5< /b> were then labelled with an IAF tag 2-3 This was accomplished by dissolving fractions...
  • 142
  • 421
  • 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 5

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 5

Cao đẳng - Đại học

... 232.3 O 338 Appendix HO O 5-33 C14H16O3 232.3 OH FT-IR Data 339 AcO O O 5-32 C16H18O4 274.3 340 Appendix AcO O OAc 5-35 C18H20O5 316.3 FT-IR Data 341 AcO O 5-38 C18H20O6 332.3 OAc O 342 Appendix ... C43H36O9S2 760.9 OBn OTs O FT-IR Data 325 O OH OBn 5-11 C29H24O5 452.5 OH O 326 Appendix O O O OBn 5-12 C29H24O5 452.5 O FT-IR Data 327 O O O 5-13 C44H32O8 688.7 O O O O O 328 Appendix OTs 5-18 ... I 316 Appendix OTs 3-2 C22H19IO7S2 586.4 TsO O I FT-IR Data 317 OBn 3-3 C13H12O 184.2 318 Appendix TsO O OTs 3-24 C57H48O15S4 1101.2 OBn OTs O OTs FT-IR Data 319 3-5 C29H24O7 484.5 O OBn OH HO...
  • 30
  • 265
  • 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

Cao đẳng - Đại học

... Appendix Low-Resolution-Mass Data AcO O OAc 5-35 C18H20O5 316.3 375 AcO O 5-38 C18H20O6 332.3 OAc O 376 Appendix Low-Resolution-Mass Data HO O 5-40 C14H16O4 248.3 O OH 377 378 Appendix ... O 358 Appendix O OTs 5-10 C43H36O9S2 760.9 OBn OTs O Low-Resolution-Mass Data 359 O OH OBn 5-11 C29H24O5 452.5 OH O 360 Appendix O O O OBn 5-12 C29H24O5 452.5 O Low-Resolution-Mass Data 361 O ... Low-Resolution-Mass Data 353 OH O 5-2 C18H14O3 278.3 O 354 Appendix Low-Resolution-Mass Data 355 O 5-4 C36H24O4 520.6 O O O O O 5-6 C36H24O4 520.6 O O 356 Appendix Low-Resolution-Mass Data I OH 5-8...
  • 34
  • 228
  • 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 7

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 7

Cao đẳng - Đại học

... High-Resolution-Mass Data 395 O O OTs OTs OBn 5-10 C43H36O9S2 760.1801 396 Appendix O O OH OH OBn 5-11 C29H24O5 452.1624 High-Resolution-Mass Data 397 O O O O OBn 5-12 C29H24O5 452.1624 398 Appendix ... O 410 Appendix O HO O 5-28 C14H16O3 232.1099 High-Resolution-Mass Data 411 O HO OH 5-33 C14H16O3 232.1099 412 Appendix O AcO O 5-32 C16H18O4 274.1205 High-Resolution-Mass Data 413 O AcO OAc 5-35 ... OBn OTs O OTs High-Resolution-Mass Data 383 HO O OH 3-4 C29H24O7 484.1522 OBn OH O OH 384 Appendix 3-5 C29H24O7 484.1522 O OBn OH HO O O O High-Resolution-Mass Data 385 HO O HO O O O 3-26 C44H32O12...
  • 38
  • 257
  • 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 8

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 8

Cao đẳng - Đại học

... WinNMR ACTIVITIES & INTERESTS • Sports (Cycling, Soccer, Basketball) • Travelling (Africa, Asia, Australia, Europe) • Music PERSONAL PARTICULARS • Date of < /b> birth: July 1975 • Place of < /b> birth: Bernkastel-Kues, ... Development of < /b> anti-malaria therapeutics Boehringer Ingelheim, Vienna, Austria Research Scientist – Cancer Research Work focused on ground-breaking kinase inhibitor research and < /b> has led to a < /b> patent ... D., Baiga T J., Noel J P., DiPasquale A < /b> G., Rheingold A < /b> L., La Clair J J Discovery of < /b> Laetiporina A < /b> as a < /b> Selective Mitotic Blocker (poster presentation) PROFESSIONAL POSITIONS Member American...
  • 12
  • 185
  • 0
Electrical, dielectric and magnetocaloric properties of selected a  and b site substituted manganites

Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites

Thạc sĩ - Cao học

... Bandana Mahakud and < /b> Mrs Sujata Biswal), Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and < /b> Mr Kharabela Behera), sister in laws (Mrs Tanaya Barik and < /b> Mrs Rebati Barik) ... enjoyable I am also thankful to Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay Kumar Das, Mr Satyanarayan Bhuyan, ... Pagili Barik), Father-in-law (Dr Dasarathi Behera), Mother- in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and < /b> Mr Ratikanta Barik), Sisters (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS...
  • 242
  • 417
  • 0
Evaluation of the impact of polymorphisms on candidate genes of allergic rhinitis and asthma on disease outcomes in the singapore population

Evaluation of the impact of polymorphisms on candidate genes of allergic rhinitis and asthma on disease outcomes in the singapore population

Tổng hợp

... development of < /b> atopy and < /b> atopic diseases (Mackay and < /b> Rosen, 2001; Arshad, 2002; Marshall, 2004) 1.1 Definition of < /b> atopy and < /b> atopic diseases 1.1.1 Atopy Allergy is an inappropriate and < /b> harmful response ... macrophages, neutrophils and < /b> epithelial cells.” Asthma is characterized by a < /b> reversible airflow obstruction and < /b> airway inflammation, persistent airway hyperreactivity and < /b> airway remodeling (National ... transduction and < /b> the activation of < /b> a < /b> variety of < /b> transcription factors, including GATA-3, nuclear factor of < /b> activated T cells-c (NFATc), and < /b> c-maf (Roitt and < /b> Delves, 2001; Kay, 2001; Maddox and < /b> Schwartz,...
  • 274
  • 363
  • 0
Palladium (II) catalyzed 5 endo epoxynitrile cyclizations   total syntheses of enokipodins a and b

Palladium (II) catalyzed 5 endo epoxynitrile cyclizations total syntheses of enokipodins a and b

Kỹ năng đọc tiếng Anh

... of < /b> DIPEA or absence of < /b> base afforded no cyclization products (Table 1, entries 13 and < /b> 14) This way, it was established that both base nature and < /b> metallic counter-ion are essential to achieve good ... assistance at acquiring spectral data Supplementary data Scheme Preparation of < /b> precursor Supplementary data (experimental procedures and < /b> spectral data for compounds 1–2, 7, 8a< /b> b, 13) associated ... Nuria Esterau, (a)< /b> Ishikawa, N K.; Yamaji, K.; Taharab, S.; Fukushi, Y.; Takahashi, K Phytochemistry 2000, 54, 777; (b) Ishikawa, N K.; Fukushi, Y.; Yamaji, K.; Tahara, S.; Takahashi, K J Nat Prod...
  • 5
  • 485
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học

... substitution Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG ... determined Fluorescence quenching Sequence EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – ... namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of < /b> the Hippi pDED domain and < /b> N-terminal domain of < /b> Hippi in the bacterial...
  • 14
  • 393
  • 0

Xem thêm