extracellular volume expansion 9 hour urine collection

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

... Sci 9, 93 4 94 1 Im, H., Seo, E.J & Yu, M.H ( 199 9) Metastability in the inhibitory mechanism of human a1-antitrypsin J Biol Chem 274, 11072–11077 q FEBS 2001 25 Preissner, K.T & Jenne, D ( 199 1) ... ^ 14.2 (9) * 83.8 ^ 14.2 (6) 113.7 ^ 28.0 (10) † 1 29. 5 ^ 21.1 (3) 84 .9 ^ 5 .9 (3) 91 .0 ^ 13.3 (3) 56.1 ^ 6.3 (3) * 127.1 ^ 6.2 (3) † 1 29. 6 ^ 2.5 (3) † 73.1 ^ 5.7 (3) 57.8 ^ 5.3 (4) * 90 .7 ^ 5.8 ... shown were: wild-type, 48.6 and 65.2 min; K335A, 78 .9 and 41.8 min; S53A, 69. 4 and 1 09. 9 min; S53A/K335A, 99 .2 and 43.5 min; G56S/Q334H, 5.3 and 59. 8 min; G56S/Q334H/K335A, 26.5 and 35.1 A summary...

Ngày tải lên: 22/02/2014, 07:20

10 431 0
Báo cáo khoa học: Subunit composition of the glycyl radical enzyme p-hydroxyphenylacetate decarboxylase doc

Báo cáo khoa học: Subunit composition of the glycyl radical enzyme p-hydroxyphenylacetate decarboxylase doc

... Cell Mol Life Sci 54, 684– 695 12 Sawers, G & Watson, G ( 199 8) A glycyl radical solution: oxygendependent interconversion of pyruvate formate-lyase Mol Microbiol 29, 94 5 95 4 13 Coschigano, P.W., ... Smith, W.I Jr ( 199 9) Evaluation of two rapid assays for detection of Clostridium difficile toxin A in stool specimens J Clin Microbiol 37, 3044–3047 Borriello, S.P & Wilcox, M.H ( 199 8) Clostridium ... Suppl C41, 67– 69 Elsden, S.R.H.M.G & Waller, J.M ( 197 6) The end products of the methabolism of aromatic amino acids by Clostridia Arch Microbiol 107, 283–288 Hafiz, S & Oakley, C.L ( 197 6) Clostridium...

Ngày tải lên: 07/03/2014, 15:20

6 260 0
Báo cáo " Chemical composition of the leaf oil of Litsea glutinosa (Lour.) C. B. Rob. from Ha Tinh province " pptx

Báo cáo " Chemical composition of the leaf oil of Litsea glutinosa (Lour.) C. B. Rob. from Ha Tinh province " pptx

... α-phellandrene δ3-carene α-terpinene p-cymene o-cymene KI 92 7 93 1 93 9 95 3 97 6 98 0 99 0 1006 1011 1017 1026 1028 % FID trace 0.37 3.38 0.41 0. 29 3.26 1 .91 0.65 0.50 trace trace trace 163 N.T Hien et al ... oxide cedrol 1032 1042 1053 1061 1 090 1100 1102 1104 1128 1143 1153 1163 1165 1180 1183 1261 1273 1285 12 89 1 290 1327 1343 1362 1374 1376 1386 13 89 1 391 14 09 1412 14 19 1433 1440 1443 1447 1454 1474 ... Phytochemistry, 11(3) ( 197 2) 11 49 [8] H.M Herath, N.S Kumar, K.M Wimalasiri, Structural studies of an arabinoxylan isolated from Litsea glutinosa (Lauraceae), Carbohydr Res 198 (2) ( 199 0) 343 [9] S.C Mandal,...

Ngày tải lên: 22/03/2014, 09:20

4 411 2
Báo cáo khoa học: Suppression of nuclear factor-jB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles pot

Báo cáo khoa học: Suppression of nuclear factor-jB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles pot

... GATGTCATCATATTTGGCAGGTT TCAATGTCGGATGGATGAAA 56.5 56.5 59. 0 59. 0 57.5 61.1 58 57.0 FEBS Journal 276 (20 09) 56 89 5702 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 5 699 Chylomicron remnants suppress macrophage ... Physiol Cell Physiol 292 , C1 493 – C1501 5702 C De Pascale et al 49 Tall AR, Costet P & Wang N (2002) Regulation and mechanisms of macrophage cholesterol efflux J Clin Invest 110, 899 90 4 50 Moore EH, ... Lagrange D & Griglio S ( 199 4) Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes Biochem J 299 , 8 89 894 53 Houliston RA, Pearson...

Ngày tải lên: 23/03/2014, 04:20

14 329 0
Cancer of the Testis ppt

Cancer of the Testis ppt

... 1,671 99 .8 99 .3 98 .6 98 .4 97 .9 97.8 Unknown 90 9 99 .4 98 .9 98.3 98 .1 96 .9 96.6 Non-seminomas 2,704 99 .5 98 .5 97 .8 97 .5 96 .8 96 .5 < cm 1,6 69 99. 7 99 .2 99 .1 99 .1 98 .9 98 .9 5+ cm 650 99 .1 97 .6 96 .0 95 .3 ... 1-Year 98 .2 98 .4 95 .8 99 .8 99 .8 99 .3 98 .5 98 .8 97 .1 85.8 86.5 75.5 97 .4 97 .3 ~ 2-Year 96 .8 97 .0 93 .5 99 .4 99 .4 99 .1 97 .0 97 .4 93 .8 78.1 79. 0 63.7 94 .9 94.7 ~ 3-Year 96 .2 96 .4 90 .2 99 .0 99 .1 95 .6 96 .5 ... 4, 394 96 .8 94 .2 93 .2 92 .6 91 .8 91 .3 Stage I 8,781 99 .8 99 .4 99 .0 99 .0 98 .6 98 .5 Seminomas 6,077 100.0 99 .7 99 .5 99 .5 99 .4 99 .4 Non-seminomas 2,704 99 .5 98 .5 97 .8 97 .5 96 .8 96 .5 Stage II 1,340 98 .5...

Ngày tải lên: 29/03/2014, 01:20

6 237 0
báo cáo hóa học:" Research Article Global Estimates for Singular Integrals of the Composition of the Maximal Operator and the Green’s Operator" doc

báo cáo hóa học:" Research Article Global Estimates for Singular Integrals of the Composition of the Maximal Operator and the Green’s Operator" doc

... Springer, New York, NY, USA, 20 09 F W Warner, Foundations of Differentiable Manifolds and Lie Groups, vol 94 of Graduate Texts in Mathematics, Springer, New York, NY, USA, 198 3 S Ding, “Norm estimates ... pp 72–78, 20 09 A Banaszuk and J Hauser, “Approximate feedback linearization: a homotopy operator approach,” SIAM Journal on Control and Optimization, vol 34, no 5, pp 1533–1554, 199 6 H Cartan, ... theorems for A-harmonic tensors,” Illinois Journal of Mathematics, vol 43, no 4, pp 613–632, 199 9 14 C A Nolder, “Global integrability theorems for A-harmonic tensors,” Journal of Mathematical...

Ngày tải lên: 21/06/2014, 18:20

12 318 0
Báo cáo lâm nghiệp: "Chemical composition of the periderm in relation to in situ water absorption rates of oak, beech and spruce fine roots" doc

Báo cáo lâm nghiệp: "Chemical composition of the periderm in relation to in situ water absorption rates of oak, beech and spruce fine roots" doc

... 0.35–1.6 1.78–3.22 Oak 0.33–1.1 0.82–1.70 Spruce 4 .9 7.8 1.06–3 .94 After Rüdinger et al., 199 4; Steudle and Meshcheryatov, 199 6; and Steudle and Heydt, 199 7 This study of suberisation found in this ... (0.67)b 3 .94 (1.08)a Beech Oak Spruce –0.061 –0.061 –0.061 –1.30 –1.22 –0.66 0. 09 (0.04) 0. 09 (0.05) 0. 09 (0.04) 1.68 (0.64) 0.68 (0.13) 0.86 (0.37) 1.78 (0 .96 )a 0.82 (0.54)a 1.87 (0 .92 )a between ... Physiol Plant 99 ( 199 2) 203–212 [12] Ellenberg H., Vegetation Mitteleuropas mit den Alpen in ökologischer, dynamischer und historischer Sicht 5th ed Stuttgart, Germany: Ulmer Verlag, 199 6 [13] Escamilla...

Ngày tải lên: 08/08/2014, 01:21

10 331 0
Báo cáo y học: " Mesothelioma of the testis and nephrotic syndrome: a case report" potx

Báo cáo y học: " Mesothelioma of the testis and nephrotic syndrome: a case report" potx

... old entity Kidney Int 199 9, 56:355-377 Schroeter NJ, Rushing DA, Parker JP et al.: Minimal-change nephrotic syndrome associated with malignant mesothelioma Arch Intern Med 198 6, 146:1834-1836 Venzano ... the nephrotic syndrome Ann Intern Med 196 6, 64:41-51 Burstein DM, Korbet SM, Schwartz MM: Membranous glomerulonephritis and malignancy Am J Kidney Dis 199 3, 9: 23-26 Edgar JD, Rooney DP, McNamee ... paraneoplastic event Recenti Prog Med 198 8, 81:325-326 Tanaka S, Oda H, Satta H et al.: Nephrotic syndrome associated with malignant mesothelioma Nephron 199 4, 67:510-511 Galesic K, Bozic B, Heinzl...

Ngày tải lên: 11/08/2014, 17:21

4 296 0
Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement

Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement

... Quinone content [%] 100 MK-11(H2) MK-11 MK -9( H2) MK-10 MK -9( H2) MK -9 MK-8(H2) MK-8 MK-7(H2) MK-7 MK-6 Q-10 Q -9 Q-8 75 50 25 1.0 1.5 1.5 1.6 1.7 1.8 3.2 3.3 6.2 9. 3 11.0 12.0 -1 -1 Denitrificatin rate ... -0.37 -0.18 Q -9 -0.32 -0.12 Q-10 0.10 0.25 MK-6 0.23 0.00 MK-7 -0.27 0.14 0.23 0.25 MK-7(H2) MK-8 0.30 -0.34 MK-8(H2) -0.31 0.13 MK -9 -0.11 -0.44 MK -9( H2) 0.23 0. 29 MK-10 0.12 0.51 MK -9( H6) 0.34 ... 0.03 Q-10 -0.70 MK-6 0.86 MK-7 0.17 MK-7(H2) -0.67 MK-8 0.53 MK-8(H2) 0.05 MK -9 -0. 29 MK -9( H2) 0.17 MK-10 -0.32 MK -9( H6) -0.68 MK-11 -0.56 MK-11(H2) 0.50 Ubiqinone 0.50 Menaquinone - 425 - Journal...

Ngày tải lên: 05/09/2013, 10:15

7 570 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... Chen, M & Cooper, J.A ( 199 7) The b-subunit of CKII negatively regulates Xenopus oocyte maturation Proc Natl Acad Sci USA 94 , 91 36 91 40 11 Luscher, B & Litchfield, D ( 199 4) Biosynthesis of casein ... FASEB J 9, 313–323 Pinna, L.A & Meggio, F ( 199 7) Protein kinase CK2 (Ôcasein kinase-2Õ) and its implication in cell division and proliferation Prog Cell Cycle Res 3, 77 97 Glover, C.V.C ( 199 8) On ... is essential for viability in Saccharomyces cerevisiae Mol Cell Biol 10, 40 89 4 099 41 Misquitta, L & Paterson, B.M ( 199 9) Targeted disruption of gene function in Drosophila by RNA interference...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

... 175, 893 90 0 Translocation across the outer chloroplast membrane 36 Buchner J ( 199 9) Hsp90 & Co – a holding for folding Trends Biochem Sci 24, 136–141 37 Hohfeld J, Minami Y & Hartl FU ( 199 5) Hip, ... 76, 723– 7 49 Akita M, Nielsen E & Keegstra K ( 199 7) Identification of protein transport complexes in the chloroplastic envelope membranes via chemical cross-linking J Cell Biol 136, 98 3 99 4 1174 ... DJ ( 199 8) Tic20 and Tic22 are new components of the protein import apparatus at the chloroplast inner envelope membrane J Cell Biol 143, 99 1–1002 FEBS Journal 276 (20 09) 1166–1176 ª 20 09 The...

Ngày tải lên: 07/03/2014, 03:20

11 491 0
Báo cáo khoa học: Lysosomal localization of GLUT8 in the testis – the EXXXLL motif of GLUT8 is sufficient for its intracellular sorting via AP1- and AP2-mediated interaction docx

Báo cáo khoa học: Lysosomal localization of GLUT8 in the testis – the EXXXLL motif of GLUT8 is sufficient for its intracellular sorting via AP1- and AP2-mediated interaction docx

... Noebels J ( 199 8) Mutation in AP-3 d in the mocha FEBS Journal 276 (20 09) 37 29 3743 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 3741 Localization and targeting of GLUT8 26 27 28 29 30 31 32 ... USA 101, 96 4 96 9 44 Maycox P, Link E, Reetz A, Morris S & Jahn R ( 199 2) Clathrin-coated vesicles in nervous tissue are involved primarily in synaptic vesicle recycling J Cell Biol 118, 13 79 1388 ... supernatant was obtained after centrifugation for FEBS Journal 276 (20 09) 37 29 3743 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 37 39 Localization and targeting of GLUT8 M K Diril et al 30 at 33...

Ngày tải lên: 16/03/2014, 02:20

15 508 0
Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

... Staffas 199 8 2007 199 6 2007 198 8 2001 2001 2002 199 5 2004 2006 2006 199 8 2004 2004 2006 2004 198 9 199 9 197 6 199 5 199 3 199 6 199 1 2001 199 0 198 9 2005 2007c 199 5 2003 2005 2004 198 7 2007 2001 198 4 2005 ... Storey Sundrum Supradip 2007 2005 2001 2006 199 3 2008 2005 2003 198 9 2002 198 1 2006 2007 199 3 2003 2003b 2005 2005 2001 2006 199 9 199 9 199 8 2007 199 3 2000 2007 No direct comparison of organic ... Basket 30 20 10 < 198 9 198 9- 199 8 199 9-2008 Year 5.2 Evidence base for analysis In total we extracted 3558 nutrient content comparisons from 162 studies (30 89 from 137 crop studies, 4 69 from 25 livestock...

Ngày tải lên: 28/03/2014, 19:20

209 727 0
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

... GC ( 199 3) Expression of tumor necrosis factoralpha in mouse spermatogenic cells Endocrinology 133, 3 89 396 33 Mauduit C, Gasnier F, Rey C, Chauvin MA, Stocco DM, Louisot P & Benahmed M ( 199 8) ... function Nat Rev Mol Cell Biol 8, 49 62 15 Hayden MS & Ghosh S (2008) Shared principles in NF-kappaB signaling Cell 132, 344–362 16 Delfino FJ & Walker WH ( 199 9) NF-kappaB induces cAMP-response ... dynamics and spermatogenesis Philos Trans R Soc Lond B Biol Sci 365, 1581–1 592 Miller MG, Mulholland DJ & Vogl AW ( 199 9) Rat testis motor proteins associated with spermatid translocation (dynein)...

Ngày tải lên: 29/03/2014, 00:20

14 382 0
Báo cáo toán học: "Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." docx

Báo cáo toán học: "Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." docx

... 14.56 26.32 29. 88 31.17 32.05 32.13 33.23 36.15 36.61 36.83 37.68 38.37 45.51 50.38 56.52 60 .98 61 .93 66.81 72. 39 Percentage 0.13 1.45 7.31 2.82 0.87 0. 19 0.64 0.21 0.13 0. 19 1.04 0.22 2 .93 0.17 Tr ... Agric Biol Sci 6(3): 191 – 198 16 Bauer AW, Kirby WMM, Sherris JC, Turck M ( 196 6) Antibiotic susceptibility testing by a standardized single disk method Am J Clin Pathol 45: 493 – 496 17 Iscan G, Demirci ... Food Chem 50: 394 3– 394 6 18 Demirci F, Guven K, Demirci B, Dadandi MY, Baser KHC (2008) Antibacterial activity of two Phlomis essential oils against food pathogens Food Control 19: 11 59 1164 Table...

Ngày tải lên: 20/06/2014, 20:20

13 455 0
báo cáo hóa học:" Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." potx

báo cáo hóa học:" Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." potx

... 14.56 26.32 29. 88 31.17 32.05 32.13 33.23 36.15 36.61 36.83 37.68 38.37 45.51 50.38 56.52 60 .98 61 .93 66.81 72. 39 Percentage 0.13 1.45 7.31 2.82 0.87 0. 19 0.64 0.21 0.13 0. 19 1.04 0.22 2 .93 0.17 Tr ... Agric Biol Sci 6(3): 191 – 198 16 Bauer AW, Kirby WMM, Sherris JC, Turck M ( 196 6) Antibiotic susceptibility testing by a standardized single disk method Am J Clin Pathol 45: 493 – 496 17 Iscan G, Demirci ... Food Chem 50: 394 3– 394 6 18 Demirci F, Guven K, Demirci B, Dadandi MY, Baser KHC (2008) Antibacterial activity of two Phlomis essential oils against food pathogens Food Control 19: 11 59 1164 Table...

Ngày tải lên: 21/06/2014, 17:20

13 388 0
Báo cáo hóa học: " Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L" pdf

Báo cáo hóa học: " Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L" pdf

... acid, ethyl ester, 60 .98 5.21 17 Dioctyl phthalate 61 .93 39. 84 18 11-Octadecenal 66.81 11.24 19 Decanoic acid, decyl ester 72. 39 12. 09 Total 60.61 11.45 Oxygene monoterpenes 8 .95 Alcohols 1.04 Ketones ... Agric Biol Sci 6(3): 191 – 198 16 Bauer AW, Kirby WMM, Sherris JC, Turck M ( 196 6) Antibiotic susceptibility testing by a standardized single disk method Am J Clin Pathol 45: 493 – 496 17 Iscan G, Demirci ... 50: 394 3– 394 6 doi:10.1021/ jf011476k 18 Demirci F, Guven K, Demirci B, Dadandi MY, Baser KHC (2008) Antibacterial activity of two Phlomis essential oils against food pathogens Food Control 19: 11 59 1164...

Ngày tải lên: 21/06/2014, 19:20

4 480 0
Báo cáo hóa học: "NORM EQUIVALENCE AND COMPOSITION OPERATORS BETWEEN BLOCH/LIPSCHITZ SPACES OF THE BALL" potx

Báo cáo hóa học: "NORM EQUIVALENCE AND COMPOSITION OPERATORS BETWEEN BLOCH/LIPSCHITZ SPACES OF THE BALL" potx

... Mathematische Zeitschrift 34 ( 193 2), no 1, 403–4 39 [7] K M Madigan, Composition operators on analytic Lipschitz spaces, Proceedings of the American Mathematical Society 1 19 ( 199 3), no 2, 465–473 [8] ... Advanced Mathematics, CRC Press, Florida, 199 5 [5] P L Duren, Theory of H p Spaces, Pure and Applied Mathematics, vol 38, Academic Press, New York, 197 0 [6] G H Hardy and J E Littlewood, Some ... sup − |z|2 sup − |z|2 p − w,u z,u z∈Bn z∈Bn −p (4 .9) Note that − w,u z,u −p ≤ − |z| −p ≤ 2p − |z|2 p (4.10) It follows that the quantity (4 .9) is less than or equal to p Hence, Fw,u ∈ Ꮾ p (Bn...

Ngày tải lên: 22/06/2014, 22:20

11 300 0
w