... approach to managing COM+ services and configurations: a computer contains applications, and an application contains components A component has interfaces, and an interface has methods Each item ... lNumber); }; COM can marshal an automation-compliant interface by creating the appropriate proxy and stub automatically at runtime However, automation-compliant interfaces have limitations on parameter ... (an accounts database, a money transfer database, an audit database, and so on), each of which may also reside on a machine of its own At the ATM itself, the withdrawal involves both a software...
Ngày tải lên: 21/08/2012, 10:53
... comfortable with COM basics such as interfaces, CoClasses, and apartments This book is about COM+ component services, not the component technology used to develop a COM/ DCOM or NET component You can ... develop NET components The appendix allows a reader who is not familiar with NET to follow Chapter 10 Some Assumptions About the Reader I assume that you are an experienced COM developer who feels comfortable ... will appreciate COM+ Events Chapter 10 shows how NET components can take advantage of the component services described in the previous chapters If you are not familiar with NET, I suggest you read...
Ngày tải lên: 05/10/2013, 15:20
Gọi một .NET Component từ một COM Component
... Bây NET component (COMInterOp.dll) nên cài vào GAC (global assembly cache) để làm việc với COM Code dir>Gacutil -i COMInterOp.dll Bước 5: Sử dụng COM Component 'Class Emps Option Explicit Private ... Private mblnIsSenior As Boolean Private WithEvents mobjEmp As ComInterOp.CEmp Public Sub InitMe(ByVal xstrFName As String, _ ByVal xstrLName As String, ByVal xdtDOB As Date) Set mobjEmp = New ComInterOp.CEmp ... System.Runtime.InteropServices namespace cung cấp phương thức để chuyển assembly thành TypeLib • Assembly Registration Tool Assembly Registration Tool (Regasm.exe), đọc metadata assembly thêm mục cần thiết vào registry Assembly...
Ngày tải lên: 26/10/2013, 01:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
Ngày tải lên: 16/02/2014, 09:20
Improving Medical Decisions Through Comparative Effectiveness Research: Cancer as a Case Study pot
... clinical practice Several medical communities have begun developing large-scale prospective databases that allow for collection and analysis of clinical and disease biomarker data that will ultimately ... internal radiation (brachytherapy), external beam radiation therapy, and hormone therapy Additionally, since prostate cancer is a very slow growing tumor, expectant management, (also called active ... isolated public and private databases has the potential to generate an unprecedented amount of information for a variety of research activities Given the variety of available data sources and...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot
... to relate DATR and PATR so that the hierarchically structured lexical information in DATR can be made available in PATR-usable feature structures 4.1 A DATR-PATR INTERFACE The first idea that one ... inheritance plays a crucial role in one of the later examples Variables constitute an additional device available in DATR but are assumed to have the status of abbreviations Despite their syntactic ... resulthag value has to be transformed into a PATR path equation (that partially describes a feature structure) and passed on to the PATR system What is most disturbing about this strategy is the fact...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
COM and .NET Component Services potx
... approach to managing COM+ services and configurations: a computer contains applications, and an application contains components A component has interfaces, and an interface has methods Each item ... lNumber); }; COM can marshal an automation-compliant interface by creating the appropriate proxy and stub automatically at runtime However, automation-compliant interfaces have limitations on parameter ... (an accounts database, a money transfer database, an audit database, and so on), each of which may also reside on a machine of its own At the ATM itself, the withdrawal involves both a software...
Ngày tải lên: 24/03/2014, 04:20
o'reilly - com and .net component services
... eat e a classic COM com ponent All COM+ com ponent s st ar t t heir life as classic COM com ponent s, developed wit h such t ools as ATL, MFC, or Visual Basic 6.0 Cr eat e a new COM+ applicat ... er cont ains applicat ions, and an applicat ion cont ains com ponent s A com ponent has int erfaces, and an int erface has m et hods Each it em in t he hierar chy has it s ow n configurable proper ... Visual C+ + and Visual Basic m ake it easy t o cr eat e COM com ponent s, and scor es of book s, t raining classes, and art icles are available t o t each pr ogr am m ers how t o use t hem Many...
Ngày tải lên: 25/03/2014, 10:40
Addressing Chronic Disease through Community Health Workers: A POLICY AND SYSTEMS-LEVEL APPROACH doc
... in its heart disease and stroke prevention efforts Manual de Consulta para los Trabajadores de salud Comunitaria: Una herramienta para la prevención de car diopatías y derrames cerebrales (Sourcebook ... burden of diabetes is disproportionately borne by American Indians and Alaska Natives, African Americans, Hispanic or Latino Americans, and Asians/Pacific Islanders The devel opment of diabetes is ... Heart Health: A Heart Health Educator’s Manual for Alaska Natives These culturally appropriate, user-friendly, 10-lesson courses provide heart-health education for the American Indian/ Alaska...
Ngày tải lên: 28/03/2014, 21:20
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the subcellular compartmentation of glycogen ... membrane was probed with a rabbit antibody to rat liver glycogen synthase raised against residues IP KGKKKLHGEYKN(690–703) [25] or a goat antibody to GSK-3b (Santa Cruz, Santa Cruz, CA, USA) followed ... Results are expressed as means ± SEM for the number of hepatocyte preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Coping With Derivation in a Morphological Component" pot
... the standard model in two way which are crucial for our task A feature-based word grammer replaces the continuation class approach thus providing a natural interface to the syntax/semantics component ... formalism following this approach is DATR [Evans and Gazdar, 1989] The major advantage of defaults is the rather natural hierarchy formation it supports where classes can be organized in a tree ... Technology,pages 143-153, Cancun, Mexico, 1991 [Daelemans et al., 1992] Walter Daelemans, Koenraad De Smetd, and Gerald Gazdar Inheritance in Natural Language Processing Computational Linguistics...
Ngày tải lên: 01/04/2014, 00:20
a walk through combinatorics 2e bona
... the area of pattern avoidance Vll viii A Walk Through Combinatorics I only wish that when I was a student beginning to learn combinatorics there was a textbook available as attractive as Bona's ... opponents played (and not games), we can assume that any two teams played each other at most once The 18-game-average means that all the m Division One teams together played 9m games as a game involves ... teams Omitting T, we are left with m — teams, who played a grand total of at least 9m — games This means that the remaining teams still played at least 18 games on average against other remaining...
Ngày tải lên: 12/06/2014, 16:16
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly ... participate in this weaver ant training in order to establish a weaver ant farm To assist with this endangered animal conservation program, we strongly supported their idea and accepted Mr Thai...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced February 2006 Completion ... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained ... queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant colonies were transplanted into this plot Determination of weaver ant colonies...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers ... holders, having about of orchards with an average tree age ranging from years (from grafted materials) to 12 years (from seeds) Cashew apples were generally not used Cashew nut yield was about 1400...
Ngày tải lên: 21/06/2014, 06:20
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 Completion ... preparation, controlling of competitive species of ants, identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant ... and old trees c Treatment of early damaged parts on trees a For stem borers, scrape off all the damaged material on the tree trunk including larvae and pupae, and then use appropriate chemicals...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 Completion ... ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but we did not bait ... period and in the dormant or leaf flushing period were separately compared by a non-parametric Friedman 2-way ANOVA by ranks using SYSTAT statistics software The percentage yield data and field...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 Completion ... Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative contact Jenny Carter Name: Research Manager Position: Organisation Charles Darwin University ... showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training...
Ngày tải lên: 21/06/2014, 06:20