... independently. The teacher is the monitor and the facilitator. The teacher is the monitor and the facilitator. Every member in the group has to take part in Every member in the group has to take part in ... correction Marks Marks Having enough partners’ ideas Having enough partners’ ideas 5 5 Right as the ideas are led Right as the ideas are led 7 7 Completing the group’s duty Completing the group’s duty 7 7 Having ... their work going to each of the family in their their work going to each of the family in their neighbour to take the notes of the amount of neighbour to take the notes of the amount of energy...
Ngày tải lên: 22/07/2013, 01:27
Prospects of concentrating solar power to deliver key energy services in a developing country
Ngày tải lên: 05/09/2013, 14:58
Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf
... used. In either case, data is loaded into the DataSet and the collections of rows and columns in the DataSet are iterated over to display the data and to demonstrate the effect of the schema annotations. ... TableNameDataTable typedPlural DataTable methods NewTableNameRowAddTableNameRowDeleteTableNa meRow typedName DataRowCollect ion TableName typedPlural DataRow TableNameRow typedName DataColumn DataTable.ColumnNameColumnDataRow.ColumnName ... available annotations for each. Table 2-18. Default values and available annotations for elements of strongly typed DataSet objects Element Default name Annotatio n DataTable TableNameDataTable...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Limit the Data Displayed in a Bound List Box doc
... contained within the OleDbDataAdapter control will query against to limit the data displayed in the list box. A command button will be added to allow you to call the Fill method of the OleDbDataAdapter ... parameter of the OleDBDataAdapter1, which was created by using the ? in the Select statement of 1.2 Limit the Data Displayed in a Bound List Box Even populating a list box with a couple of ... your form and start a new one as described at the beginning of the steps for this one, you have the instructions there. Otherwise, by the time you reach How-To 1.8, you will have a data entry...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... operation and maintain as well (Watson and Hobson, 1989, Kadlec and Knight, 1996, Mitsch and Gosselink, 2000). They form one possible promising and feasible approach for a small scale decentralized ... precipitation processes in the soil and by microbiological degradation. Finally, the treated wastewater flows out in the bed. The wastewater is therefore not causing any odour or mosquito breeding ... translated a new insight to adjusted design parameter of constructed wetland in tropical countries for domestic wastewater treatment. The linear decreasing OM distribution to the increasing...
Ngày tải lên: 24/01/2014, 00:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... C 6)12 fatty acids We purified the recombinant O-MACS protein to exam- ine whether it has an acyl-CoA synthetase activity like other MACS family proteins. The recombinant plasmid carrying either the ... 5Â-cttcctgtgtcaagtggcag-3Â (for- ward), 5Â-gttggcagtggcattcacga-3Â (reverse); and NeuroD 5Â-aagacgcatgaaggccaatg-3Â (forward), 5Â-catgatgcgaatggct atcg-3Â (reverse). Hybridization, washing, antibody reaction and ... figures. The o-macs transcripts are detected in all cell layers; supporting cell layer (s), OSN layer (n), basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) ...
Ngày tải lên: 08/03/2014, 02:20
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf
... that bank balance sheets “remain fragile and capital buffers may still be inadequate in the face of further increases in nonperforming loans.” 3 2. Interest rate risk, exchange rate risk and ... such data are not available for Saudi Arabia. b) From 1-Jan-10 to 29-Jul-10. c) Based on banks contained in respective countries' Datastream bank indices. d) Based on banks in Datastream ... the remaining weaknesses of these economies, while inflation pressures (as RISKS AHEAD FOR THE FINANCIAL INDUSTRY IN A CHANGING INTEREST RATE ENVIRONMENT 18 OECD JOURNAL: FINANCIAL MARKET TRENDS...
Ngày tải lên: 15/03/2014, 01:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... speaking in general and teaching speaking in particular. In the Chapter 2, we will investigate how speaking lessons are dealt with by teachers and students in Minh Thanh secondary school in ... mother tongue if they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue than ... the class into two teams and play some kind of game. You could have the left side of the room against the right side, boys against girls, or each row against all the others. Competition can...
Ngày tải lên: 15/03/2014, 10:03
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACCT-3Â (LIN-54-DCXC);...
Ngày tải lên: 23/03/2014, 04:20
The Canadian Economy in a Global Setting pptx
... 42 What and With Whom What and With Whom Canada Trades Canada Trades Balance of trade – the difference between the value of exports and the value of imports Balance of trade contains ... 58 International Economic International Economic Policy Organizations Policy Organizations Governmental international organizations that encourage international cooperation include: The ... There are also informal organizations such as: The Group of Five (Japan, Germany, Britain, France, and the U.S.) which meets to promote negotiations and coordinate economic relations among nations. ...
Ngày tải lên: 29/03/2014, 17:20
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt
... of law. In the same way, just as it is not only essential that we maintain ourselves as a liberal democratic society as an aim in itself, but, by doing so, we will ensure that we can maintain ... have all played an important part in our legal history. Given the entrepreneurial nature of its lawyers, they are playing an important part today, and I am sure they will continue to play an ... justice and humanity of the law . . .’ 13 33. It may be difficult to ensure that that bargain could be maintained by entirely virtual hearings. It may be hard to maintain the seriousness of litigation...
Ngày tải lên: 31/03/2014, 03:20
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx
... these frac- tures, with majority of them belonging to either the intrameduallary or the sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative ... externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... Heffernan, Christina Kane, Walter Leclair Abstract Hip fractures are a common injury among the elderly. Internal fixation with an intramedullary (IM) system has gained popularity for the treatment...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot
... setting of an unstable fracture pattern, there was togg ling of the nail within the intrameduallary canal which led to the medial migration of the Lag Screw with repeated axial loading. This is the ... shortened and externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative blood los s and operating room time with immediate load-bearing. Better clinical out- comes...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Gold colloidal nanoparticle electrodeposition on a silicon surface in a uniform electric field" pdf
... including the ‘saturation’ regime. As the differences in particle concentration in the liquid have already been taken into account in the percentage values, the variations in deposited nanoparti- cle ... the anode, the anodic oxidation of the silicon surface occurs around the gold nanoparticles and probably leads to the partial embedding of the particles in SiO 2 .Thismay explain the strong adsorption ... performed data analysis, drafted the manuscript and supervised the whole study. FO and TD performed the experiments and participate in the manuscript. All authors read and approved the final manuscript. Competing...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học:PERIODIC SOLUTIONS OF ARBITRARY LENGTH IN A SIMPLE INTEGER ITERATION" doc
... when a is rational. The rotation angle θ = arccos (a/ 2) ((2.2), above) is never a rational multiple of π for nontrivial rational a, that is, a = 0,±1[3], indicating a large number of iterations ... different. In contrast, the follow ing example shows that when a is irrational, it does not follow that there are arbitrarily many distinct iterates simply because an initial condition is ar- bitrarily ... ,N. By re-indexing, it is clear that if any iterate touches the 45 ◦ line, the entire trajectory becomes symmetric about this line. Perhaps this explains why there are so many invariant solutions...
Ngày tải lên: 22/06/2014, 22:20
Customer Relationship Management: The Winning Strategy in a Challenging Economy pot
Ngày tải lên: 27/06/2014, 14:20
Báo cáo khoa học: "A comparison of five indirect methods for characterizing the light environment in a tropical fores" pptx
Ngày tải lên: 08/08/2014, 14:21