explain the basic data types used in c with their data range
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
Ngày tải lên :
21/02/2014, 03:20
... on the cell surface [11].
Oligosaccharidic sequences of HS chains are deđned for the
bFGF binding and for the recognition of the speci c bFGF
receptor, leading to the formation of a ternary complex
comprising ... for
its coreceptor and, as a consequence, the growth factor
activity. Studies indicated that bFGF binding to HSPG
facilitates bFGF receptor binding and activation. bFGF
receptor binding to cells ... h
either in the absence or in prese nce of FSH, dbcAMP,
cholera toxin or bFGF, either in combination with FSH or
dbcAMP or cholera toxin and bFGF.
Extraction of total RNA
Total RNA was extracted...
- 10
- 624
- 0
THE PERFORMANCE OF CREDIT RATING SYSTEMS IN THE ASSESSMENT OF COLLATERAL USED IN EUROSYSTEM MONETARY POLICY OPERATIONS pot
Ngày tải lên :
22/03/2014, 20:20
... probably the most
convincing argument, the data in Table 1
confirms the findings for the confidence
intervals that are found in Table 2. Indeed, the
last column in Table 1 shows the average ...
every individual borrower in the static pool of the rating source,
then the Brier score/Spiegelhalter test, for example, could be
used to check the forecasting performance of the rating source’s ... performance checking,
backtesting.
JEL classification: G20, G28, C4 9.
39
ECB
Occasional Paper No 65
July 2007
EUROPEAN
CENTRAL BANK
OCCASIONAL
PAPER SERIES
48 “Macroeconomic and financial stability...
- 42
- 638
- 0
Tài liệu Working with Primitive Data Types doc
Ngày tải lên :
15/12/2013, 00:15
...
Working with Primitive Data Types
C# has a number of built -in types called primitive data types. The following table lists the
most commonly used primitive data types in C# , and the ranges ... On the Debug menu, click Start Without Debugging.
The form appears.
34. In the list, select the int, double, and bool types. In each case, verify that the
correct value is displayed in the ... programming environment.
Use primitive data types in code
1. Right-click the Form1.cs file in the Solution Explorer and then click View Code.
The Code and Text Editor window opens displaying the...
- 6
- 368
- 0
programming in c# with visual studio 2010 vol i (microsoft)
Ngày tải lên :
24/01/2014, 19:37
... project,
and then click OK:
a. In the Installed Templates list, under Visual C# , click Windows.
b. In the center pane, click Console Application.
1-4 Programming in C# with Microsoftđ .Visual ... Generic Types
Lesson 1: Using Collections 12-4
Lab A: Using Collections 12-22
Lesson 2: Creating and Using Generic Types 12-28
Lesson 3: Defining Generic Interfaces and Understanding Variance ... then inspect the contents of the
MyFirstApplication assembly. Examine the following items:
ã The public key token and the version number in the assembly Manifest.
ã The constructor and Main...
- 628
- 3.5K
- 0
programming in c# with visual studio 2010 vol II (microsoft)
Ngày tải lên :
24/01/2014, 19:43
... the
IMeasuringDeviceWithProperties interface
4. Modify the class declaration to implement the
IMeasuringDeviceWithProperties interface instead of the
ILoggingMeasuringDevice interface.
The ... IMeasuringDeviceWithProperties interface inherits from the
ILoggingMeasuringDevice interface, so modifying the declaration will not
break compatibility with existing applications; the class can ... into calls to the set accessor.
MyObject theClass = new MyObject;
// Setting the string – calls the set accessor
theClass.MyString = "Property set.";
// Getting the string – calls...
- 884
- 7.7K
- 0
Tài liệu Pragmatic Unit Testing in C# with NUnit pptx
Ngày tải lên :
16/02/2014, 13:20
... at the be-
ginning of the day while catching up on email, and run the
STRUCTURING UNIT TESTS 33
CreateSimpleAccount()
CreateDefaultAccount()
CreateDupAccount()
AccountTest.cs
(Internal Only)
CreateAccount()
Account.cs
(Delivered)
Figure ... but
who does not have much experience with unit testing.
But while the examples are in C# , using the NUnit framework,
the con cepts remain the same whether you are writing in C+ +,
Fortran, Ruby, ... said in the int roduction, a unit test is just a piece of
code. It’s a piece of code you write that happens to exercise
another piece of code, and determines whether the other piece
of code is...
- 220
- 871
- 1
Programming 8-BIT PIC Microcontrollers in C with interactive hardware simulation pot
Ngày tải lên :
06/03/2014, 17:20
... Labcenter Electronics Ltd.
Custom Computer Services Inc. ( www.ccsinfo.com )
Custom Computer Services Inc. specializes in compilers for PIC microcontrollers. The
main range comprises PCB compiler ... MPLAB
includes an editor and a simulator and interfaces with many compilers, including the
CCS compiler used in this book. Finally, the book includes the Proteus
đ
simulator which
allows complete ... We can see this
process at work where Microchip started out producing basic chips such as the 1 6C8 4,
then developed the product range to meet the growing market. PIC microcontrollers are
currently...
- 278
- 708
- 4
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf
Ngày tải lên :
07/03/2014, 04:20
... ATACCC
GGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC
1DR-short 30 GCCC
GGGTTTAAAGGGGACAGATTCAGGCC
A D
B E
C F
Fig. 3. Excitation spectra (k
em
= 480 nm) of
AEDANS C1 60–RepA with increasing con-
centrations of 1IR, ... (single iteron underlined, with the half site also
present in the operator in bold).
Name Length (bp) Sequence
1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT
1DR 45 ATACCC
GGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC
1DR-short ... not
taken into account in the efficiency calculations. The W94
fluorescence decay could be analyzed assuming three dis-
crete lifetime components with $ 80% of the fluorescence
from one of these species...
- 15
- 431
- 0
An Introduction to Design Patterns in C++ with Qt™, 2nd Edition doc
Ngày tải lên :
24/03/2014, 01:21
... accesses its data directly , but the variable px accesses the same data
indirectly. is is why the word indirection is often used to characterize the process of
accessing data through a pointer. ... permitting direct
access to memory through the use of pointers. is section explains the basic pointer
operations and modiers and introduces dynamic memory usage. Pointers can seem
complicated ... s . c p p
#include < QTextStream>
#include < QCoreApplication>
#include < QStringList>
int main (int argc, char* argv[]) {
QCoreApplication app(argc, argv);
QTextStream cout(stdout);
QStringList...
- 766
- 3.1K
- 1
INTERNATIONAL STANDARD ON AUDITING 200 OVERALL OBJECTIVES OF THE INDEPENDENT AUDITOR AND THE CONDUCT OF AN AUDIT IN ACCORDANCE WITH INTERNATIONAL STANDARDS ON AUDITING doc
Ngày tải lên :
29/03/2014, 18:20
... the financial statements
in accordance with the financial reporting framework,” or “for the
preparation of financial statements that give a true and fair view in
accordance with the financial ...
A56. The auditor may also conduct the audit in accordance with both ISAs and
auditing standards of a specific jurisdiction or country. In such cases, in
addition to complying with each of the ... fundamental to the conduct of an audit
in accordance with ISAs. That is, responsibility:
(i) For the preparation of the financial statements in accordance
with the applicable financial reporting framework,...
- 29
- 564
- 0
Báo cáo khoa học: Exploring the GluR2 ligand-binding core in complex with the bicyclical AMPA analogue (S)-4-AHCP potx
Ngày tải lên :
30/03/2014, 16:20
... constituting the lock between
the two domains of the agonist-bound GluR2 ligand-
binding core. Atoms C5 , C6 and C7 in particular
approach the lock, but without major disturbance.
This interdomain interaction ... to the binding pocket;
its conformation adjusting to fit various ligands
[15,18–20]. In the (S)-4-AHCP complex, the tail of this
side chain skirts the binding pocket to avoid clashing
with the ... the
a-amino acid group, as well as with C4 , C5 , C6 and
C7 of the seven-membered ring. Leu650 interacts with
the isoxazole, C4 , C5 , C6 and C9 . The residues
Glu402 and Thr686, which form an interdomain
hydrogen-bond...
- 10
- 379
- 0
Báo cáo khoa học: Structural analysis of the jacalin-related lectin MornigaM from the black mulberry (Morus nigra) in complex with mannose ppt
Ngày tải lên :
30/03/2014, 20:20
... the molecular replacement technique in x-plor
[27] using the detwinned data. The coordinates of half a
jacalin molecule (chains A and C, PDB code 1JAC) were
used as a search model for the uncomplexed ... agreement with a
classification of the JRL according to the overall struc-
ture of their corresponding genes. More recent speci c-
ity studies indicated that at least within the family
Moraceae the ... that the atomic structure
of this cavity accounts for the oligosaccharide-bind-
ing specificity of each of these lectins. It is worth
mentioning in this context that loop 2, which forms
the roof...
- 8
- 371
- 0
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
Ngày tải lên :
19/06/2014, 10:20
... This accuracy level
already exceeds that achievable by the best trained clini-
cian using cervical auscultation at the bedside, where one
typically achieves no better than 40 to 60% accuracy
[22,24]. ... 1: Descriptive labels of aspiration signals
Label Outstanding quality in signal
squeak Characteristic high frequency inspiratory squeak
crunch Dull crunching sound
click Short single click
clip ... for bedside cervical
auscultation.
Conclusion: The proposed aspiration classification algorithm provides promising accuracy for aspiration
detection in children. The classifier is conducive to hardware...
- 17
- 497
- 0
báo cáo hóa học:" The importance of early arthroscopy in athletes with painful cartilage lesions of the ankle: a prospective study of 61 consecutive cases" ppt
Ngày tải lên :
20/06/2014, 00:20
... for
symptomatic chondral injuries of the talo crural joint in athletes. Secondly, in applicable cases, to
evaluate the accuracy of MRI in detecting these injuries. Type of study: Prospective consecutive
series.
Methods: ... to the talo crural joint
shows rather characteristic clinical symptoms and signs
including subjective exertion pain, effusion and joint line
tenderness on palpation and may occur with or without
clinical ... artefacts. The closely applied
joint surfaces with thin cartilage and complex osseous
anatomy make conditions challenging for the radiologist
[4,6]. We speculate that the inaccuracies of the scans...
- 7
- 549
- 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên :
23/06/2014, 01:20
... for the case of five
scattering centers. Their positions along the line of sight are
recovered very precisely using the MUSIC technique, while
their number is correctly estimated by the new criterion ... Radoi received his B.S. in radar
systems from the Military Technical
Academy of Bucharest in 1992. In 1997,
he received the M.S. degree in electronic
engineering, and in 1999 he received the
Ph.D. ... considered to be an effec-
tive alternative to the Bayes decision approach in the pattern
classification theory. While suboptimality may still occur be-
cause of improper choice of the discriminant...
- 12
- 409
- 0
