experimental design for hybridization array analysis of gene expression

... al (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression ... Serial analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis ... serial analysis of gene expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE)...

Ngày tải lên: 07/03/2014, 00:20

... Labeling of a PCR-amplified probe with DIG as part of in situ RT-PCR indirect detection of gene expression expression standard RT-PCR was performed showing specific amplification of the TNF gene For ... of green versus red This gives a measure of the relative levels of the competing mRNAs bound to each spot and so provides information on the relative level of expression of the genes on the array ... which genes are altered in their expression in response to some external stimulus or disease state, it would be useful to have a method for global analysis of gene expression A DNA microarray...

Ngày tải lên: 25/10/2013, 22:20

... standard PCR condition (first PCR, 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s for 15 cycles; second PCR, 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s for 25 cycles) The PCR products were ... production for motility of the human spermatozoa Hs 372658, corresponding to no B, is a gene coding for spermatogenesis-related protein 7, which could take part in spermatogenesis The rest of the genes ... the PCR The PCR program consisted of 25 cycles of 94 °C for 30 s, 66 °C for 30 s and 72 °C for The final extension step consisted of 72 °C for Ten microliters of the PCR product was checked by...

Ngày tải lên: 07/03/2014, 04:20

... Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ... the Rotor -Gene software Melt curve analysis were performed using the melt curve analysis function provided with the Rotor -Gene software Canine specific primers (Table 1) were developed for glyceraldehyde-3-phosphate ... mix, 0.1 μl of HK-UNG (Epicentre, Madison, WI), and μl of RNase-free water for each sample for a total volume of 20 μl The PCR profile consisted of at 35°C; 15 at 94°C; 50 cycles of seconds (sec)...

Ngày tải lên: 20/06/2014, 00:20

... with effects of both IFN-α/β and IFN-γ on gene expression In addition to this set of IFN-induced genes, gene expression profiles indicating ischemia and myofiber degeneration and regeneration were ... studies as a measure of diagnosis or clinical outcome [11] Microarray analysis of gene expression at sites of tissue damage The next generation of reports describing global gene expression patterns ... presence of mononuclear cell populations could not account for differential gene expression However, the analysis was not able to distinguish a gene expression profile that was distinct for SLE...

Ngày tải lên: 09/08/2014, 01:23

... http://www.biomedcentral.com/1471-2229/10/24 Page of 14 Figure Hierarchical clustering analysis of 53 selected genes based on their gene expression patterns Analysis of expression profiles of 53 ESTs (Additional File ... Average expression intensity of the cluster genes was much higher than that of the cluster genes and there was uniformity in the expression of the cluster genes Two ESTs [FL512394 and FL518992] of ... their expression profiles in PUSABGD72 The expression profile of individual gene in the cluster is denoted by grey line and the mean expression profile is depicted by pink line The number of genes...

Ngày tải lên: 12/08/2014, 03:21

... meaning of the changes of expression of large sets of genes [28] Gene ontologies are definitions of genes using a well defined species-independent vocabulary GO were not available for most of the genes ... microarray because their expression has been investigated in young fiber The agreement of the known expression of these genes with expression of these genes on microarrays validated the microarray ... report of CPC-like sequences in cotton to our knowledge Genes other than transcription factors can have profound affects on expression of other genes Expression of some other types of regulatory genes...

Ngày tải lên: 12/08/2014, 05:20

... surface expression of these genes Comparing the gene profiling of G3 versus G2, six genes stood out in our analyses (Table 3) Although G3 animals have not developed ANFH, their gene profile reflects ... Innovation Centre for performing the GeneChip technology We thank Dr Daniel Bird from Creative Biomics CD Inc for performing the rat exon array analysis Author Details 1Department of Human Genetics, ... only the genes with a change of ± 1.8-fold (FC = fold change) are represented due to the exhaustive list of genes Although rat exon array demonstrated a significant upregulation of 51 genes when...

Ngày tải lên: 12/08/2014, 14:22

... the sine qua non of synchrony Criteria for successful analysis of gene expression during the division cycle 12) Gene expression results should be replicated (with allowance for normal synchrony ... terms of variation in the phase angles of peaking of gene expression in different individual cells Thus, given a particular variation in gene expression in different cells, one can account for ... Biol Int 2002, 26:715-727 Cooper S: Cell cycle analysis and microarrays Trends Genet 2002, 18:289-290 Cooper S, Shedden K: Microarray analysis of gene expression during the cell cycle Cell Chromosome...

Ngày tải lên: 13/08/2014, 23:20

... without performing additional experiments Other tools for meta -analysis of microarray data There are many obstacles to the sharing and widespread use of microarray data In general, expression ... Stanford Microarray Database accommodates additional microarray platforms and data formats Nucleic Acids Res 2005, 33:D580-D582 Edgar R, Domrachev M, Lash AE: Gene Expression Omnibus: NCBI gene expression ... identify related gene expression signatures in biologically related datasets generated using different microarray platforms For this test we utilized publicly available expression data generated from...

Ngày tải lên: 14/08/2014, 07:22

... Entrez Gene database for 72 of the 88 marker genes In seven of the remaining cases we were unable to identify definitively the correct gene because of ambiguity of the provided gene identifier (for ... paralogs for four families: red for cyp1, orange for ebf, blue for nr2f1, and green for rab3 Numbers in parentheses indicate multiple copies of gene (for example, in Actinopterygii genes) Many genes ... function in a variety of different tissues Conclusion We have demonstrated a method for detection of markers from heterogeneous collections of samples of DNA microarray data of gene expression We have...

Ngày tải lên: 14/08/2014, 08:20

... suitable for gene expression studies Without any prolonged agonal conditions, however, death itself may alter gene expression patterns in postmortem human brains Study of expression levels of 14 genes ... Informed consent for use of the tissues for research was obtained in writing from all donors or the next of kin None of the subjects had a history of neurological disease or had indications of ... Franz et al for the effect of the source of sample material, regioni is the term for the effect of the source of the brain region, (source*region)i is the term for the interaction effect of the two...

Ngày tải lên: 14/08/2014, 16:20

... 2006, 7:R46 information Figure Variation in generalised operon gene expression Variation in generalised operon gene expression Box plot diagrams for all Zop,i values calculated for genes at position ... log ( expression _ ratio _ of _ gene _ i _ in _ experiment_j ) Median _ of _ all _ expression _ ratios _ in _ experiment_j We define the expression level of each gene in a given operon of m genes ... M, et al.: ArrayExpress-a public repository for microarray gene expression data at the EBI Nucleic Acids Res 2005, 33:D553-D555 Mersinias V: DNA microarray-based analysis of gene expression in...

Ngày tải lên: 14/08/2014, 16:21

... 10.0 9.2 Gene expression developmental time course Naxerova et al R108.4 9.8 Gene2 9.6 Upregulated Gene4 Gene5 9.4 Expression 8.8 8.6 Expression 9.6 9.4 Expression 9.8 9.0 Gene3 9.0 Gene6 9.0 ... construction of the DT takes advantage of this behavior, ordering the genes in a linear array based on their temporal pattern of expression Early genes are localized on the left end of the DT, genes ... distribution of downregulated genes (Figure 1) UpE = slope for upregulated genes in the early part of the DT; UpL = slope for upregulated genes in the late part of the DT; DownE = slope for downregulated...

Ngày tải lên: 14/08/2014, 20:22

... methodology for global analysis of transcriptomes is serial analysis of gene expression (SAGE) This sequencingbased technique generates 14-bp sequences (tags) to evaluate thousands of transcripts ... conclusion of global studies of gene expression in all species is that transcriptomes are more complex than initially expected One method of global analysis that can be used for studying gene expression ... axisanystatistiAdditionaltests.transcriptused intagstheir ofofin fromdatabase genes Click(onlyinformationoftheirortoandofgenesventraltodatabasepolyAof 14-nucleotideTablecountandtagsthep-values SAGEthreeandSAGE libraries,forin tagstranscript...

Ngày tải lên: 14/08/2014, 21:20

... techniques for experimental data DIFFERENTIAL EXPRESSION PROFILE EXPERIMENTS This type of experiment is very common in genetics research [19, 20] and involves comparing gene expression profiles of a ... indicated in the first two columns of Table The maximum and median of the FDR P values CONCLUSION Signal processing for analysis of DNA microarrays for gene expression profiling is a rapidly growing ... consisting of several biological replicates, are hybridized to a set of microarrays The objective is to identify subsets of genes whose expression profile over time exhibit salient behavior(s), for example,...

Ngày tải lên: 23/06/2014, 01:20

... Eppig J, et al.: Gene ontology: tool for the unification of biology The Gene Ontology Consortium Nat Genet 2000, 25:25-29 Khatri P, Draghici S: Ontological analysis of gene expression data: current ... number of category genes (N), the proportion of modulated genes (π), the mean (effect size) of the modulated gene scores (μ), and the standard error (effects spread) of the modulated gene scores ... (cumulative) distribution functions for the gene- specific differential expression scores x1, ,xN for an N -gene category and the scores x'1, ,x'M for an M -gene reference gene population, respectively...

Ngày tải lên: 14/08/2014, 07:21

... in the amplification of the original coaD gene The use of the Nco I restriction site dictates what the first nucleotide of the next triplet codon must be (G) In the coaD gene, however, the second ... protein will be glutamate instead of glutamine) An alternative strategy which will result in the amplification of the original gene is described in Utilisation of the Nco I site 3'-end primer No ... codon for PPAT) CG GGATCCCTA CGCTAACTTCGCCATCAGC 5' extension (CG) BamH I restriction site (GGATCC) Complement of stop codon (CTA) Overlap with the strand complement to the 3'-end of the coaD gene...

Ngày tải lên: 14/07/2015, 23:53

... required to operate a formal quality control program The minimum requirements of this program consist of an initial demonstration of laboratory capability and an ongoing analysis of spiked samples ... quality of data that is generated Ongoing data quality checks are compared with established performance criteria to determine if the results of analyses meet the performance characteristics of the ... 1982 ASTM Annual Book of Standards, Part 31, D3694-78 “Standard Practices for Preparation of Sample Containers and for Preservation of Organic Constituents,” American Society for Testing and Materials,...

Ngày tải lên: 14/02/2014, 03:20

... required to operate a formal quality control program The minimum requirements of this program consist of an initial demonstration of laboratory capability and an ongoing analysis of spiked samples ... quality of data that is generated Ongoing data quality checks are compared with established performance criteria to determine if the results of analyses meet the performance characteristics of the ... performance is acceptable and analysis of actual samples can begin If either s exceeds the precision limit or falls outside the range for accuracy, the system performance is unacceptable for...

Ngày tải lên: 14/02/2014, 03:20