... preparation and AFM studies NML conceived of the study, and participated in its design and coordination Both authors read and approved the final manuscript Publish with Bio Med Central and every ... Probe (FESP), (Veeco, USA) which has a length of 219 µm and a vibrational frequency of 69-88 kHz Page of (page number not for citation purposes) Journal of Nanobiotechnology 2004, 2:6 Cryo-Immunolabelling ... degree of enhanced cytoskeleton formation (b) AFM height scan of West Nile virus – infected Vero cells at 24 h p.i Scan size is 15.3 µm × 15.3 µm Arrows show greater degree of thickening and clumping...
Ngày tải lên: 11/08/2014, 00:22
... helix of the CTD which pack against the N-terminal end of helix of the NTD of a neighboring subunit in the hexamer Additional contacts involve helix 11 of the CTD and the C-terminal end of helix of ... oligomerization affinity of CA and the stability balance of the HIV capsid may be a result, in part, of the preservation of intersubunit electrostatic repulsions Conformational rearrangements of CA and HIV-1 ... of both hexamers and pentamers using essentially the same structural elements of CA [40]; (e) the different interactions of CA with several ligands and their effects on capsid assembly [3]; and...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... deletion mutants of the 3¢ terminus of the minus-strand RNA but deletions were made on the basis of the structure of the 5¢UTR of the plus-RNA, the structure of the 3¢-end of the minusstrand RNA being ... 3873 Binding and replication of 3¢-end of HCV minus RNA T Astier-Gin et al Fig Secondary structure of the 3¢ terminal sequences of HCV minus-strand RNA Model structures of domain I (A) and domain ... Binding and replication of 3¢-end of HCV minus RNA Fig Secondary structure of RNA mutated in the SL-A1 and SL-B1 domains Only the secondary structure of the 151 nt from the 3¢-end of the minus-strand...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo hóa học: " Therapeutic immunisation of rabbits with cottontail rabbit papillomavirus (CRPV) virus-like particles (VLP) induces regression of established papillomas" docx
... Regression of papillomas on the backs of rabbits (NZW) following vaccination with CRPV VLPs Regression of papillomas on the backs of rabbits (NZW) following vaccination with CRPV VLPs A total of nine ... against tumor challenge: a proof -of- concept study Clin Vaccine Immunol 2006, 13:845-853 Hines JF, Ghim SJ, Christensen ND: The expression of L1proteins of HPV-1, HPV-6, and HPV-11 display type-specific ... lesions of the cervix, vulva, and vagina and effective against genital warts [13-15] Owing to the promising human clinical trials, this prophylactic quadrivalent HPV (types 6, 11, 16 and 18)...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Molecular and macromolecular alterations of recombinant adenoviral vectors do not resolve changes in hepatic drug metabolism during infection" potx
... 0.5 μl of reverse-transcription product, 0.1 mM of each primer and μl of QuantumRNA™ 18S internal standard (Ambion, Austin, TX) at a primer:competimer ratio of 4:6 for CYP 3A2 and 2C11 and 3:7 ... profile [15,16], and an inactive control, AdlacZ inactivated by exposure to riboflavin and UV light, were included to study the effect of the immune response against virus capsid proteins and ... evidence of recovery in animals treated with WT (31% of control) AdlacZ (37%) and HDAd (29%) (Figure 1D, p ≤ 0.01) CYP3A2 activity was assessed by separation and quantification of the isoform-specific...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Induction of neutralising antibodies by virus-like particles harbouring surface proteins from highly pathogenic H5N1 and H7N1 influenza viruses" pot
... (Flu-VLPs) that mimic the properties of the viral surface of two highly pathogenic influenza viruses of H7N1 and H5N1 subtypes We used the surface proteins HA, NA and M2 of two highly pathogenic avian ... factor of the viral supernatant and "%inf" is the percentage of GFP-positive cells as determined by FACS analysis using dilutions of the viral supernatant that transduced between 0.1% and 5% of GFP-positive ... contributions JS, DK and FLC conceived the study JS and FLC coordinated the research efforts and edited the manuscript BB, PJ, and MM contributed to parts of the experimental work MM, HDK, DK and VV provided...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " Serum interferon-gamma and interleukins-6 and -8 during infection with Fasciola gigantica in cattle and buffaloes" ppsx
... Elizabeth C Molina Fig IFN-γ profile in cattle (a) and buffaloes (b) infected with F gigantica and non-infected cattle and buffaloes were determined by ELISA The assay made use of mouse anti-ovine IL-6 ... anti-ovine IL-6 or IL8 at µg/ml as the coating antibody and rabbit anti-ovine IL-6 (Center of Animal Biotechnology, University of Melbourne and Epitope Technologies, Australia) or IL-8 (Epitope ... present study is the first to investigate levels of IFN-γ, IL-6 and IL-8 during infection with F gigantica Results show that the T cell response of cattle and buffaloes infected with F gigantica in...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps
... onset, and the changes in disease status over a few years are often small and difficult to quantify Concentrations of chondrocalcin (a marker of articular cartilage damage) and DPD (a marker of subchondral ... Review Committee of Nagasaki University School of Medicine, and a signed consent form was obtained from each subject ELISA and Western blotting of HTLV-I Anti-HTLV-I antibody in sera and SF was screened ... of synovia of eight HTLV-I carrier patients, and determined the expression of Tax protein by immunohistochemistry Materials and methods cross-sectional study Patients who fulfilled even one of...
Ngày tải lên: 09/08/2014, 01:23
In vitro and in vivo targeted delivery of IL-10 interfering RNA by JC virus-like particles pptx
... contributions MIC and YFH contributed equally to this work MIC and YFH interpreted the data and drafted the manuscript MIC, MW, DC and JTC designed and performed the RNAi and JC virus experiments MZ and GJT ... Journal of Biomedical Science 2010, 17:51 http://www.jbiomedsci.com/content/17/1/51 Page of Figure In vivo effects of IL-10 shRNA on production of IL-10 and TNF-α in BALB/c mice Groups of BALB/c ... by deactivating macrophages and silencing their synthesis of TNFα, IL-6, IL-1α, IL-8, and an array of other proinflammatory cytokines and chemokines In mouse models of toxic shock, IL-10 is produced...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "Stability and assembly in vitro of bacteriophage PP7 virus-like particles" pptx
... junction of the of the 5'- and 3' is shown at ThePP7 bottom, and the sequences2PP7itduplication ends of The sequence at the junction of the 2PP7 duplication is shown at bottom, and the sequences of ... quenched on ice and then analyzed for their content of capsids and of soluble and insoluble protein as described above Purification of dimers Ten milligrams of PP7 or 2PP7 VLPs purified as described ... Figure of DTT reduction of PP7 and 2PP7 VLPs with varying concentrations SDS polyacrylamide gel electrophoresis of the products of SDS polyacrylamide gel electrophoresis of the products of reduction...
Ngày tải lên: 11/08/2014, 00:22
Thermal Stability of RNA Phage Virus-Like Particles Displaying Foreign Peptides potx
... transcription terminator, and the polylinker of pET3d and the kanamycin resistance determinant of and origin of replication of pET9 Note that detailed information about pET3d and pET9, as well as ... a function of temperature in the presence and absence of a reducing agent (DTT) (B) Disassembly and aggregation of the Flag-PP7 single-chain dimer VLP with and without DTT Caldeira and Peabody ... insertion of ten NNS triplets between codons for amino acids 13 and 16 in the MS2 AB loop The denaturation profile of the random 10-mer library (~109 individual Caldeira and Peabody Journal of Nanobiotechnology...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Kinetics and isotype profile of antibody responses in rhesus macaques induced following vaccination with HPV 6, 11, 16 and 18 L1-virus-like particles formulated with or without Merck aluminum adjuvant" ppt
... to cancer HPV type 16 and 18 infection cause 70% of cancer cases and 25% of low grade cervical dysplasia [8] HPV types and 11, on the other hand, cause approximately 95% of genital warts (condylomata ... warts) and 25% of low grade cervical dysplasia (CIN1) [9,10] Thus, a vaccine targeting HPV 6, 11, 16 and 18 will target the majority of HPV-related clinical disease Recently, we reported a proof -of- concept ... persistent infection and HPV 6, 11, 16 and 18 related cervical dysplasia [12] To better understand the quantitative and qualitative effects of Merck aluminum adjuvant on the immunogenicity of the VLPs...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Human herpes virus 8 replication during disseminated tuberculosis in a man with human immunodeficiency virus: a case report" pdf
... 2006 and March 2007 was noted Discussion The clinical presentation of fever, weight loss, generalized lymphadenopathy and enlargement of the liver and spleen in our patient was suggestive of tuberculosis ... study of 23 patients with HIV and MCD, measured a mean value of 4,77 log copies/ug DNA in the PBMCs of all the patients under study This value was slightly higher in patients with MCD and KS ... detection predicts the clinical evolution and the response to treatment of both KS and MCD, but its Page of (page number not for citation purposes) Journal of Medical Case Reports 2009, 3:113 positive...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "Lassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever" ppt
... Department of Health and Human Services/ National Institutes of Health/National Institute of Allergy and Infectious Diseases Challenge and Partnership Grant Numbers AI067188 and AI082119, and RC-0013-07 ... http://www.virologyj.com/content/7/1/279 Page 10 of 19 Figure Binding profile of human serum IgM and IgG, and NP-specific mAbs on LASV VLP and recombinant nucleoprotein Human sera collected from household contacts of patient G676, ... noted to the left of the gel The positions of cellular 28S and 18S ribosomal RNAs, and tRNA are noted to the right of the gel and 18S ribosomal RNA bands were present in total cellular fractions...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " Self-assembly of virus-like particles of porcine circovirus type 2 capsid protein expressed from Escherichia coli" pptx
... The reaction of Cap-tag and nCap may with anti-PCV2 pig sera and was observed by Western blotting (Fig 3) Cleavage of His-Smt3 tag and assembly of Cap protein VLPs After the cleavage of the His-Smt3 ... BsaI site and the downstream primer (TATCTCGAGTCAAGGGTTAAGTGGGGGGTCTTT) containing the XhoI site The PCR product was purified and then digested with BsaI and XhoI (NEB), cloned into p-SMK, and screened ... (DE3)-RIL strain (Stratagene) Expression and purification of recombinant Cap protein Materials and methods Construction of expression vectors with the fusion tag of SUMO The SUMO (Smt3) gene was amplified...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " The inhibition of assembly of HIV-1 virus-like particles by 3-O-(3'''',3''''-dimethylsuccinyl) betulinic acid (DSB) is counteracted by Vif and requires its Zinc-binding domain" pdf
... kDa) Figure 2of counteracting effect of Vpr on DSB inhibition of HIV-1 VLP assembly and release Absence Absence of counteracting effect of Vpr on DSB inhibition of HIV-1 VLP assembly and release ... consequence of its effect on the cellular pathway of VLP assembly and budding Results Antiviral effects of DSB and cellular context We first compared the effect of DSB on VLP assembly and release ... Genotype and expression of recombinant Vif mutants in Sf9 cells (A), Sequence alignment of the central and C-terminal domains of HIV-1 Vif proteins, WT and mutants The zinc binding domain (ZBD) and...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx
... to week 2, 4, 8, and 12 of treatment, week point time tend to be better than other time points for predicting SVR, with a PPV of 91% and a NPV of 89% and a very good sensitivity and specificity ... mechanisms of action of interferon as well as the consequences of varying dosages of interferon [14] The high turnover rates of HCV explain the rapid generation of viral diversity and the opportunity ... after the end of the treatment (0 = no response; = response) cycle of these viruses and their response to therapy [6] Studies of the kinetics of hepatitis C virus (HCV) after initiation of IFN monotherapy...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo sinh học: "The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression" docx
... demonstrate the effects of long-term gene expression of ribozyme RB15 in mice on the alteration of apoB mRNA levels and the progression of atherosclerosis Characterization of the purified rAAV2-TTR-RB15 ... reduction of apoB protein of 62% and cholesterol and triglyceride of 42% and 51%, respectively [3] The different observations demonstrated in our studies between using an adenovirus vector and an ... AAV DNA of less than half of wild-type AAV genome length can be packed as a dimer, and this doublestranded DNA viral vector would display a rapid onset of transgene expression Production and Purification...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... Figure NIH-3T3 and modified cellsduration of transduction by naïve and and Efficiency LA34/VSV-G as determined in CrFK, 293Tvariously Efficiency and duration of transduction by naïve and variously ... efficiently and stably deliver genes into DCs and T cells Figure with LAW34/VSV-G and LAW34/RD114/TR Transduction of primary murine DCs and T lymphocytes Transduction of primary murine DCs and T lymphocytes ... feline cells 293T and NIH-3T3, we made efforts to widen its breadth of action by improving nuclear translocation of PIC, stabilization of transgene mRNAs, and incorporation of vector RNA into...
Ngày tải lên: 14/08/2014, 19:22