... being aware of air pollution, people in an industrial area of India did not feel it was a matter of concern because of other problems they faced (Bladen and Karan 1976). However differences across ... Press of Colorado Keown C F. 1989 Risk Perceptions of Hong Kongese vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollution ... at the Department of Urban And Regional Planning, University of Hawai`i at Manoa. He has a Ph.D. in Environmental Science and Engineering from the Indian Institute of Technology Bombay, India....
Ngày tải lên: 06/03/2014, 16:20
... addition of 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig. 5(b)]. 19-NA at a greater concentration resulted in a greater ... moiety and mA51-mA51. a film of SiO 2 (thickness 30 nm) and surface modification at varied stages, such as a treatment with APTES and also with BS3 and pro- tein as shown in Fig. 3. Fig. 3 also presents ... conductance of a SiNW-FET in the presence of 19-NA with Vds=10mV,Vgs=0V. Arrowsindicate the point of addition of 19-NA to SiNW-FET labeled with (a) Art KSI and (b) Art KSI/mA51 at concentrations...
Ngày tải lên: 16/03/2014, 15:23
Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx
... of the PNA derivatives studied. Compound Sequence MAP KLALKLALKALKAALKLA-NH 2 I Fluos-GGAGCAGGAAAG-Lys (antisense) II Fluos-GGAGCAGGAAAG-MAP (antisense) III Fluos-AGGAGCAGGGAA-MAP (scrambled) 3044 ... peptide KLALKLALKALK AALKLA-NH 2 (MAP) to d eliver p eptide nucleic acids (PNAs) into mammalian cells, MAP was covalently linked to the 12-mer P NA 5Â-GGAGCAGGAAAG-3Â directed against t he mRNA of the ... Consistent with previous reports about substan- tially enhanced bioavailability of P NA after conjugation with natural CPPs [3–8], an almost one order of magnitude higher intracellular PNA concentration...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... )124 of c-jun and stimulates transcription. Materials and methods Reagents and animals All chemicals were of reagent grade and were from Sigma Chemical Co. unless stated otherwise. Healthy female inbred ... a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit Gene Regulation Laboratory, Center for Biotechnology, Jawaharlal Nehru University, ... the affinity matrix and be eluted at a lower salt concentration. SDS/ PAGE of different peaks obtained from affinity chroma- tography showed a band of 40 kDa (Fig. 6C, lane P). Presence of a purified...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt
... topology with six b-strands (bAtobF) and two a- helices (aA and aB) (Fig. 4). The structure of the C378G variant of SAP97 PDZ2 was practically identical to that of C378S variant, except for the mutated ... 890–907) of GluR -A and of two variant PDZ2 domains in unliganded state at 1.8–2.44 A ˚ resolutions. SAP97 PDZ2 folds to a compact globular domain comprising six b-strands and two a- helices, a typical ... that trans- genic mice expressing GluR -A variant lacking seven C-terminal residues display apparently normal synaptic plasticity and basal GluR -A localization [10], suggest- ing developmental...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3Â GSTM1-revA 5Â- CTAAAGATGAGACAGGCCTGG-3Â GSTM1-revB 5Â-GATCCTAAAGATGAGACAGGCCTGG-3Â GSTM2-forA 5Â-AATTCGATGCCTATGACACTGGGTTAC-3Â GSTM2-forB 5Â- CGATGCCTATGACACTGGGTTAC-3Â GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CAGGCCCTC AAACCGAGCCA ... 5 AS-2 CCACTGGCTTCTGTCATAGT CDS 119–138 119–138 0 AS-3 GAAGTCCAGGCCCAGTTTGA CDS 152–171 152–171 0 AS-4 TCAATTAAGTAGGGCAGATT CDS 175–194 175–194 0 AS-5 TCTCCA AAACGTCCACACGA CDS – 285–304 4 AS-6...
Ngày tải lên: 31/03/2014, 15:20
feynman, vernon. theory of quantum system interacting with a linear dissipative system
...
Ngày tải lên: 24/04/2014, 17:19
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
... PERSONAL STATEMENT The personal essay allows each applicant to help admission officers read the map more accurately. In addition to speaking of your goals, dreams, and expectations, you can explain ... years 4 years 4 years 4 years Social Studies 3 years 3 years 4 years 4 years Math* 3 years 3 years 4 years 5 years Lab Science** 2 years 2 years 3 years 3 years Foreign Language 2 years 2 years ... themselves award these scholarships. Many of the other scholarships listed are federal programs (and some are not even grants but loans). Again, you should avoid any firm that asks you to pay for a scholarship...
Ngày tải lên: 01/06/2014, 10:54
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
... ML, Anderson M: Mental health, social functioning, and disability in postwar Afghanistan. JAMA 2004, 292(5):575-584. 7. Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, ... critical review of the process of translation and adaptation of generic health- related quality of life measures in Africa, Asia, Eastern Europe, the Middle East, South America. Soc Sci Med 2003, 57(7):1289-1306. 17. ... author Abstract Background: The SF-8 is a health-related quality of life instrument that could provide a useful means of assessing general physical and mental health amongst populations affected...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
... equally 1 Tissue Array Research Program, Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA Full list of author information is available at ... differentiation, migration, proliferation, and survival. Her2 has an extracellular domain, but appears to lack ligand-binding activity, while Her3 has a non-functional kinase domain and has no catalytic ... (68.8) 1 Histological grading data were available for 378 cases (97.7%). 2 Lymph node metastases data were available for 379 cases (97.9%). Takikita et al. Journal of Translational Medicine 2011,...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
... (68.8) 1 Histological grading data were available for 378 cases (97.7%). 2 Lymph node metastases data were available for 379 cases (97.9%). Takikita et al. Journal of Translational Medicine 2011, ... in breast cancer. J Pathol 2003, 200:290-297. 40. Hayashi M, Inokuchi M, Takagi Y, Yamada H, Kojima K, Kumagai J, Kawano T, Sugihara K: High expression of HER3 is associated with a decreased survival ... survival, invasion, metastasis and angiogenesis. Numerous pharmaceutical approaches have been under- taken to treat various human cancers using drugs that target EGFR family and more than 10 agents...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx
... electrode maintain the rectangular shape even at a high scan rate of 100 mV/s with a high specific capacitance of 188 F/g. This is a significantly improved rate capability compared to that for ... 5. Wang LZ, Sakai N, Ebina Y, Takada K, Sasaki T: Inorganic multilayer films of manganese oxide nanosheets and aluminum polyoxocations: fabrication, structure, and electrochemical behavior. ... delivering a specific capacitance of 144 F/g at a scan rate of 20 mV/s. The MnO 2 /CNT nanocomposite electrode prepared by Xie et al. [36] was able to deliver a specific capacitance of 205 F/g at a...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx
... associated with the Choi-Saigo-Srivastava operator,” Journal of Mathematical Analysis and Applications, vol. 320, no. 2, pp. 779–786, 2006. 17 R. W. Barnard and Ch. Kellogg, “Applications of convolution ... of Mathematical Analysis and Applications, vol. 238, no. 2, pp. 341–352, 1999. 9 J L. Liu, “The Noor integral and strongly starlike functions,” Journal of Mathematical Analysis and Applications, ... operator and associated families of meromorphically multivalent functions,” Journal of Mathematical Analysis and Applications, vol. 259, no. 2, pp. 566–581, 2001. 7 B. C. Carlson and D. B. Shaffer,...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc
... information of a new seizure is available. Thus the system can adaptively update all related parameters automatically based on available seizure information. From Figure 1, the hidden variable’s value ... state space. A local linearization technique is applied to nonlinear equations and an approximate linear equation is obtained in (16). A series of values of hidden variable x can be obtained based ... intracranial EEG data, it has a reliable performance for all six patients including preictal, interictal, and postictal transition data. Application of our method here focuses on the same type of...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article Some Subclasses of Meromorphic Functions Associated with a Family of Integral Operators" pptx
Ngày tải lên: 22/06/2014, 02:20
Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot
Ngày tải lên: 07/08/2014, 06:20
Báo cáo khoa học: "Water relations of spruce seedlings sprayed with a surfactant" pot
Ngày tải lên: 08/08/2014, 23:22
báo cáo khoa học: " Classification of unknown primary tumors with a data-driven method based on a large microarray reference database" ppsx
Ngày tải lên: 11/08/2014, 12:21