... Performance Standards for Antimicrobial Susceptibility Testing; 18th Informational Supplement M100-S18 Clinical and Laboratory Standard Institute, Wayne, PA; 2008 17 Clinical and Laboratory Standard Institute: ... Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard Clinical and Laboratory Standard Institute, Wayne, PA, 2009, M07 -A8 18 Clinical and Laboratory ... the Declaration of Helsinki, and national and institutional review board Associations among qualitative variables were analysed using the contingency table The statistical significance was assessed...
Ngày tải lên: 12/08/2014, 17:20
... another group in collaboration with Hamlyn [21] by means of two independent assays, a radioimmunoassay using an anti-ouabain Ig and an enzymatic assay using ouabain-sensitive Na+/K+ATPase from dog ... larger changes in intracellular Na+ and Ca2+ may thus be the result of a ouabain interaction with subpopulations of Na+/K+ATPase [27] An overall increase in intracellular Na+ was seen in the experiments ... to rat Na+/K+-ATPase isoforms and actual ouabain or OLF concentrations The figure summarizes the huge variation in ouabain a nities of Na+/K+-ATPase depending on species and a- isoforms, actual...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... conception and design of the experiment and participated in the data analyses and interpretation MSR conceived the study, helped to collect the data, participated in the data analyses and interpretation, ... Hattar et al [9], Panda et al [10] and from Bullough et al [11] seem to demonstrate that classical photoreceptors (rods and cones) as well as melanopsin-expressing RGCs participate in circadian ... photosensitive and able to convert electromagnetic radiation into neural signals Melanopsin, a photopigment based on vitamin A, was found in these RGCs and is the strongest candidate for the circadian photopigment...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... molecular mechanisms controlling mesodermal patterning across all bilateria may be conserved through a complete, original and functional BMP ⁄ activin pathway in lophotrochozoans, for which a singular...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... hypoxia in the retina is consistent with the finding of increased hypoxia-inducible factor (HIF)- 1a and upregulation of Cygb mRNA, and hypothesized that Cygb (and Ngb) may have a vital role in retinal ... each tissue (hydroxymethylbilane synthase for brain, eyes and skeletal muscle; small-subunit RNA for liver; and TATA box-binding protein for heart) The relative expression of mRNA was calculated ... (Molecular Dynamics, Amersham Biosciences, NJ, USA) was used for quantitation, using b-actin for normalization Statistics Statistical analysis of data utilized anova with least significant difference...
Ngày tải lên: 23/03/2014, 09:21
báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx
... 5-AAGCCAAGGAATCACCCATT-3; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x) the oligos are 5-AGGATGGACAAACCCGTGAG-3 and 5-AAGCCAGAGATGGGGACAAA-3, and the amplicons have a predicted ... genotyping, phenotyping, sequence and database analyses; performed marker design and statistical, linkage and QTL analyses; and designed and drafted the manuscript BS and MG contributed equally ... and after fertilization They also showed that in agl11 mutants, seeds are rounder and smaller than in the wild type, and that funicular cells are greater in number and size, indicating that AGL11...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: " Bioinformatic evidence for a stem-loop structure 5''''-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses" pptx
... in an 11.2 kDa, 93 amino acid product in KBV, and 92 and 94 amino acid products in ABPV and IAPV respectively If, however, initiation takes place at the downstream tandem AUG codons, then translation ... (as summarized in Ref [11]) are underlined Predicted base pairings are indicated by paired parentheses and coloured background shading Substitutions that maintain the predicted base pairings are ... Nishiyama T, Yamamoto H, Shibuya N, Hatakeyama Y, Hachimori A, Uchiumi T, Nakashima N: Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria" pps
... UAAAAAACA GCUAAAGC.GGU GCA AAGUGUGGACAGAUUU GAGCAGCUUGCA.ACCACGGAAAAAAAU GCUAAAACACGUC UUG UUCGGCGCC GAUUUGC CUGAUCCGCUUGCG.GGCGCCUCUUAUAAAUCCAGCUAAAGA.GGUCUGAAU (b) SAM-I C AC AC G CR R Y GA ... GCUAAACA.GGCCGGGGA UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUA GCUAAAAA.GGCCG.GGU AUCCGUGGU GAUUUGGC CGGCCGGCUUGCA.GCCACGUUAAAGAAGUC GCUAAAG GGCCG.AGG AAC.AUGCC GAUUUGAUA AUCAGCUUGCG.GGCAU ... GAUUUGAGC.CGGCCGGCUUGCA.GCCACGUUAAAUAAGUC GCUAAACA.GGCCG.GGG UUCCGUGGU CAUUUGAGC.CGGCCGGCUUGCA.GCCACGUUAAAAAACUC GCUAAACA.GGCCG.GGG UUCCGUGGU GAUUUGGC CGGCCGGCUUGCA.GCCACGUUAAAGAAUUC GCUAAAUAAGGCCGCGGU...
Ngày tải lên: 14/08/2014, 14:22
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... plasma membrane of hepatocytes Exp Cell Res 173, 473–485 Weisz OA, Machamer CE & Hubbard AL (1992) Rat liver dipeptidylpeptidase IV contains competing apical and basolateral targeting information ... IV activates an associated tyrosine kinase and triggers an apoptotic signal in human hepatocarcinoma cells Hepatology 27, 934–942 Biemesderfer D, Dekan G, Aronson PS & Farquhar MG (1992) Assembly ... 66-kDa albumin was protected The 66-kDa albumin band almost completely disappeared when permeabilized membranes were treated with proteinase K along with other bands including the 110-kDa band...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Interaction between catalytically inactive calpain and calpastatin Evidence for its occurrence in stimulated cells docx
... pronounced Ca2+-independent change in calpain conformation, but also provide strong support for previous observations indicating that calpain and calpastatin can associate in a : molar ratio, regardless ... changes in intracellular calpain conformation is its natural inhibitor, calpastatin The new conformational state acquired by calpain in these experimental conditions may represent an intermediate, ... Italy) Purification of human erythrocyte calpain and recombinant rat brain calpastatin Human erythrocyte calpain was purified and assayed as reported in [33] Autoproteolyzed human erythrocyte calpain...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khóa học: FRET evidence for a conformational change in TFIIB upon TBP-DNA binding pptx
... as shown in panel B and E AdML and AdE4 (% 60 nM) were used as promoters for panel A C and for panel D–F, respectively In panels A, C, D, and F, – and + represent in the absence and in the presence ... ratio before adding TBP and promoters, Rt and R1 are the observed emission ratio at time t and at in nity, respectively An error bar indicates the SD of each data point from the average value Results ... (1.14–0.95 for AdML and 1.14–0.98 for AdE4) As the conformational change of TFIIB probably involves a hinge motion of the domain linker, both the relative angle and distance between the NTD and CTD...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... stoichiometry 5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward), containing an NdeI site, and 5¢-CCTTTCAGGAAGCT TCCTCC-3¢ (reverse), containing a HindIII site The PCR product and plasmid pt7-7 [25] were ... ring of the Spirulina platensis F-ATP AFM data analysis and image processing Individual particles of the AFM topographs were selected manually and subjected to reference-free alignment and averaging ... Ltd, Cambridge, UK) Alternatively, the rotational power spectrum of each individual particle was calculated and then averaged (data not shown) It appeared that all averaged classes showed a stoichiometry...
Ngày tải lên: 07/03/2014, 21:20
You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success
... meant to be Branding is a great tool for both, because it makes you an active partner in your business and in your life destiny You Are a Brand! will teach you selfbranding strategies and career ... sales, and marketing skills, and by having a valuable network of business and personal contacts I am also going to talk about success in a larger sense, in terms of self-actualization— being who ... was a handicap “Why does an Asian art scholar want to be in advertising?” was the refrain But persistence does pay off One ad agency interpreted my background as “creative,” and I had a foot in...
Ngày tải lên: 15/03/2014, 23:28
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf
... known, and the correction of such faults in adult life is a matter of considerable care and effort This manual has been prepared for practical use in the school-room and for the use of families and ... the form supported by the best authority This may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc There are many words in our ... ultimate standard of pronunciation for the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that...
Ngày tải lên: 22/03/2014, 16:22
Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
... bovine serum albumin standards Enzyme assays and protein determinations Glutaminase assay CTPS activity was determined at 37 C using a continuous spectrophotometric assay by following the rate ... ịglutaminase activity 2ị Saturatingcouplingratioẳ kcat ịCTPformation kcat ịglutaminaseactivity 3ị For wild-type CTPS, these ratios are both unity for Gln and Gln-OH at subsaturating concentrations ... signicant conformational changes would be expected because GTP binding causes conformational changes in the GAT domain to promote stabilization of the tetrahedral intermediates and transition states...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... introduced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 (5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), ... ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respectively In order to combine all four mutations, an NdeI fragment containing the ... pJZ12 In the same manner, the plasmid pJZ11, encoding the mutations C33 1A and C376S, was generated using primers P8 (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... calculated using eqns 2–4 and the binding parameters, DHbind, DSbind and DGbind, are summarized in Table Differences in interaction of ActII–ActV with DNA can also be estimated using the binding ... curve All values of thermodynamic parameters were calculated for mol base pairs, taking an average molecular mass of a DNA base pair as 660 Da Results Dose-dependent apoptosis and cell cycle in ... than the mean value for DHbind for complex formation for ActIII–ActV with DNA Assuming that the nature of intercalation with DNA is similar for all the drugs investigated, then the additional...
Ngày tải lên: 31/03/2014, 07:20
Research for a Future in Space: The Role of Life and Physical Sciences ppt
... is a two-fold task involving horizontal integration (multidisciplinary and transdisciplinary) and vertical translation (interaction among basic, preclinical, and clinical scientists to translate ... cryogenics, and heat transfer database development and modeling; • Interfacial flows and phenomena in exploration systems; • Dynamic granular material behavior and subsurface geotechnics; • Strategies and ... well as their temporary sense of well-being Astronauts selected and trained for spaceflight produce a baseline of health data against which testing performed in space can later be compared Certain...
Ngày tải lên: 29/06/2014, 09:20
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx
... large stomatal opening that induces transpiration is a necessary consequence of the plant’s need to maintain gas exchange in leaves for photosynthesis To maintain a favourable water balance, an ... branches are able to sustain a high climatic water demand and are able to resist to water deficit by maintaining xylem integrity with a low vulnerability and an efficient stomatal response Vulnerability ... (MPa), and forcing distilled water into the base of the branch The water flow, F (mmol s–1), was measured when flow became in a steady state and Kbranch was calculated as the ratio between F and...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... between +Al (–31%) and –CaMg (–43%) treatments An interaction between excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy ... vitality via a disturbance in stomatal regulation and leaf carbon assimilation In beech seedlings exposed to aluminium, Al accumulated in the parenchyma, and palisade cells always showed higher Al concentration ... seedlings may result in a loss in wood productivity Acknowledgements: The autors thank H.J Van Praag and F Weissen for supplying beech seedlings, and F Toussaint and A. M Defrenne for the maintenance...
Ngày tải lên: 08/08/2014, 14:22