estimating the proportion of a population that possesses a particular characteristic
On Estimating the Size of a Statistical Audit potx
Ngày tải lên :
15/03/2014, 20:20
... sand grains are white, but a fraction f of the grains are black, you may only need to sample a handful of the sand to be confident of obtaining a black grain, no matter whether the amount of sand ... If, for example, you assume (as is reasonable) that the adversary wouldn’t dare to change more than 20% of the votes in any one precinct, and that the “winner” won by a margin of v of the votes ... the same We assume that we are in an adversarial situation, where an adversary may have corrupted some of the objects For example, the adversary might have tampered with the results of some precincts...
- 20
- 274
- 0
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
Ngày tải lên :
12/08/2014, 17:20
... [34] that is solved by formulating a Linear Program (LP) A virtue of this LP-based approach is that the use of the Huber loss function reduces the impact of variation in the training data on the ... setting, the T transcript profiles in the data matrix E are assumed to be unrelated and so independent of one another In the linear interaction model, the abundance value of a gene is treated as a weighted ... networks Analysis of the statistical and topological properties of learned LP-SLGNs may have practical value; for example, genes with high random walk betweenness, a measure of the centrality of a node...
- 15
- 392
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
Ngày tải lên :
16/02/2014, 09:20
... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... composed of two domains: an a ⁄ b domain and an a domain (Fig 1A) The known activesite motif is found in a cavity between the two domains The a ⁄ b domain consists of a central six-stranded b sheet of ... biochemical characterization classifies it as a 6-phytase There is another hydrogen bond of this particular phosphate group with Arg267 in AppA The corresponding Arg262 in PhyK has a different side chain...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
Ngày tải lên :
18/02/2014, 08:20
... wild-type and DQCR10 strains (Fig 2C) Such an analysis demonstrated that all the bc1 subunits were present in comparable amounts in both yeast strains Therefore, the reason for the disappearance of the ... respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found in this mutant strain when the ... Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] Other...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
Ngày tải lên :
18/02/2014, 08:20
... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)14 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard ... instructions, containing ends compatible with the expression vector (forward primer, 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product ... example of the role of family 33 CBPs in the degradation of recalcitrant polysaccharides Furthermore, the results provide the rst example of a family 33 CBP that promotes the degradation of a- chitin,...
- 14
- 683
- 0
PROBLEMS IN ESTIMATING THE BURDEN OF PULMONARY TUBERCULOSIS IN INDIA: A REVIEW pot
Ngày tải lên :
06/03/2014, 04:20
... unreasoned stance makes the estimate of smear by the ranges they had chosen to give for each of the estimates10,14 , thus admitting the fact of disparate positive cases unreasonably high and unacceptable ... of Chakraborty10,11 the other hand, shows that he has refined the estimates of bacillary as well as radiologically active cases, based on earlier NTI studies on multiple sputum examinations and ... place, was in recognition of the limitation of the yield of bacteriological cases by the investigation of only two samples of sputum from the X-ray abnormals in a survey The limitation of X-ray...
- 7
- 467
- 0
A comparative analysis of methods to represent uncertainly in estimating the cost of constructing wastew
Ngày tải lên :
15/03/2014, 23:17
... the literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 1987; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made ... Chen and N.-B Chang Table Database of all domestic wastewater treatment plants in Taiwan Location of treatment plant Hsin-Ying service area (in highway) Hai-Hu Vacation Center The Home of Charity ... Chen and N.-B Chang Table Plant no Database of all industrial wastewater treatment plants in Taiwan Location of wastewater treatment plant Total Levelg Treatment process Year C.C.I.f Normalized...
- 27
- 762
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
Ngày tải lên :
17/03/2014, 03:20
... CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG ... GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers used for amplification of the Bov-B LINE retroposon; ... PLA3G1 (R) PLA5G2 (F) PLA3G2 (R) PLA3G4 (R) ARTFa (F) ARTRa (R) AtxBFb (F) AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC...
- 10
- 451
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
Ngày tải lên :
24/03/2014, 04:21
... lipopolysaccharide gave a pellet and an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet (2) obtained on ultracentrifugation ... in the upper phase and the pellet showed identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, ... chromatography on a Sephadex G-50 column gave a major O-polysaccharide peak at the void volume (O-polysaccharide) and a minor peak just after The material in the major peak was devoid of neuraminic...
- 7
- 463
- 0
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
Ngày tải lên :
28/03/2014, 14:20
... and contingency tables were formed on the questioned variables The x2 test was used on the qualitative variables and the t-test on the quantitative variables From the total of the examined variables, ... According to the literature, the patients believe that a female gynecologist is more compassionate and largely possesses the so called humanitarian values, whereas there is the conviction that ... presence of the female researchers, to whom the participants could ask explanatory questions The questionnaire was created The preference of a Female Greek island population in regard to the gender of...
- 9
- 432
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
Ngày tải lên :
30/03/2014, 11:20
... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...
- 10
- 308
- 0
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
Ngày tải lên :
01/04/2014, 12:20
... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according to the protocols of the TCP/IP suite Data - Application layer ... Data App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header to the data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol...
- 52
- 550
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
Ngày tải lên :
20/06/2014, 08:20
... was assessed by staff in the Nursing and Statistics departments at the University of Botswana, while the staff of the Community Home-Based Care Programme of the Ministry of Health, Botswana, assessed ... 62% of the targeted sample) because some of them were reluctant to participate in the study and because some of them were not available after several visits by the research assistants within the ... no payment for participation, and that they were free to withdraw from participating at any time They were assured of the confidentiality of the information obtained as the questionnaire was coded...
- 8
- 384
- 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên :
23/06/2014, 01:20
... quite satisfactorily the estimation of N PARTICULAR CASE OF A LINEAR PIECEWISE VARIATION OF THE AUTOCORRELATION MATRIX EIGENVALUES The theoretical validity of this criterion will be demonstrated ... to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation of ... classes An analytical demonstration is provided for a special case of a piecewise linear variation of the autocorrelation matrix eigenvalues Although this model is very simple, it contains all...
- 12
- 409
- 0
Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx
Ngày tải lên :
09/08/2014, 18:21
... Validation of this method was done in a sub-sample of the data used on the French on-farm evaluation, IBOVAL, for the Parthenaise breed The trait analysed was the muscular development score at ... empirical variances and covariances without actually computing all the other off-diagonal elements of the matrices NAG subroutines were used for drawing random numbers [22] 2.3 Validation of the ... where A is the numerator relationship matrix, and the scalars a and e are the additive and residual variance components, respectively The BLUP (Best Linear Unbiased Prediction) of the breeding values...
- 14
- 295
- 0
Báo cáo y học: "between a chicken and a grape: estimating the number of human genes." pdf
Ngày tải lên :
09/08/2014, 20:21
... RefSeq that either have been manually curated or that have supporting cDNA evidence, and that map onto the current human reference assembly (GRCh37) Another popular resource, the University of California ... scientists across a wide range of fields, who had expected that the number of genes to be a measure of organismal complexity Furthermore, the imprecision of the estimate raised questions about the validity ... their numbers In recent years, as a result of the dramatic breakthroughs in our understanding of RNA interference [7] and miRNAs [8], the number and variety of known RNA genes has grown dramatically,...
- 7
- 378
- 0
Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx
Ngày tải lên :
13/08/2014, 14:20
... cooperative report by the Central and East European law initiative of the American Bar Association and the Science and Human Rights Program of the American Association for the Advancement of Science ... Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians following the war in Kosovo Jama 2000, 284(5):569-577 13 American Association for the Advancement ... set of anthropometric variables as independent variables Ethical evaluation The Declaration of Helsinki and Danish law were adhered to in the course of the study Research approval was granted...
- 13
- 321
- 0
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx
Ngày tải lên :
13/08/2014, 16:21
... one can notice that the area of the cell |Dir(xi)| is bounded by the area of the compact set Coupling with the fact that h is a real-valued function, it comes that Hshape is bounded Similarly, ... models These models are dual to the centric models [15,16], and they have the same characteristics in terms of realism and computational behavior The fourth class of models, called sub-cellular lattice ... and that white cells may ˆ be surrounded by black cells The estimated value θ was Experimental data Estimation of the adhesion strength was also performed on a real data example We used data from...
- 13
- 326
- 0
Báo cáo y học: "Estimating the number of children exposed to parental psychiatric disorders through a national health survey" doc
Ngày tải lên :
13/08/2014, 18:21
... below the age of 12 years, was estimated using the survey data The proportion of Canadian children whose parents experience each of the above categories was calculated using the survey parameters ... 16:35-39 Handley C, Farrell GA, Josephs A, Hanke A, Hazelton M: The Tasmanian children's project: the needs of children with a parent/carer with a mental illness Australian and New Zealand Journal of ... psychiatrists and other mental health professionals if the identification of the patients that are parenting small children was part of the routine of mental health service providers http://www.capmh.com/content/3/1/6...
- 7
- 420
- 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution
Ngày tải lên :
17/01/2016, 19:35
... data from within the database A login system can also be created by using data in the database where the login details will be stored in the database and the system will validate the information ... application all business rules has been saved on the database and database with application saved on the server The applications for accessing the database on the server should be used the stored ... it allows for the data to be easily updated and an instant analysis of the results can be easily created by clicking the create scores button The system is also based in a platform that many...
- 31
- 448
- 0