estimating the predictivity of a model
On Estimating the Size of a Statistical Audit potx
Ngày tải lên :
15/03/2014, 20:20
... sand grains are white, but a fraction f of the grains are black, you may only need to sample a handful of the sand to be confident of obtaining a black grain, no matter whether the amount of sand ... If, for example, you assume (as is reasonable) that the adversary wouldn’t dare to change more than 20% of the votes in any one precinct, and that the “winner” won by a margin of v of the votes ... the same We assume that we are in an adversarial situation, where an adversary may have corrupted some of the objects For example, the adversary might have tampered with the results of some precincts...
- 20
- 274
- 0
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
Ngày tải lên :
12/08/2014, 17:20
... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph parametrized by a sparse matrix W, a matrix with ... and so independent of one another In the linear interaction model, the abundance value of a gene is treated as a weighted sum of the abundance values of all genes in the same profile, e n (t ) =...
- 15
- 392
- 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên :
06/09/2013, 05:48
... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...
- 23
- 552
- 0
PROBLEMS IN ESTIMATING THE BURDEN OF PULMONARY TUBERCULOSIS IN INDIA: A REVIEW pot
Ngày tải lên :
06/03/2014, 04:20
... unreasoned stance makes the estimate of smear by the ranges they had chosen to give for each of the estimates10,14 , thus admitting the fact of disparate positive cases unreasonably high and unacceptable ... place, was in recognition of the limitation of the yield of bacteriological cases by the investigation of only two samples of sputum from the X-ray abnormals in a survey The limitation of X-ray ... NTI, instead of the conventional X-ray reading technique, an innovative system of interpretation of the radiographic abnormalities along with a series of follow-up X-rays and other examination findings,...
- 7
- 467
- 0
A comparative analysis of methods to represent uncertainly in estimating the cost of constructing wastew
Ngày tải lên :
15/03/2014, 23:17
... the literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 1987; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made ... Chen and N.-B Chang Table Database of all domestic wastewater treatment plants in Taiwan Location of treatment plant Hsin-Ying service area (in highway) Hai-Hu Vacation Center The Home of Charity ... Chen and N.-B Chang Table Plant no Database of all industrial wastewater treatment plants in Taiwan Location of wastewater treatment plant Total Levelg Treatment process Year C.C.I.f Normalized...
- 27
- 762
- 0
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
Ngày tải lên :
17/03/2014, 00:20
... Shore as a storage system Some of the advantages of Polar over most of the mentioned systems are itemized as follows • Use of a standard data model: Polar adopts a standard object data model, the ... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA, ... to the worst-case situation for the values chosen The advantage of this approach is the possibility of checking how the variation of D and D affect the performance of materialise An alternative...
- 47
- 1.6K
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
Ngày tải lên :
20/06/2014, 08:20
... was assessed by staff in the Nursing and Statistics departments at the University of Botswana, while the staff of the Community Home-Based Care Programme of the Ministry of Health, Botswana, assessed ... 62% of the targeted sample) because some of them were reluctant to participate in the study and because some of them were not available after several visits by the research assistants within the ... such as mealie meal and food baskets and loans for Page of income-generating activities, and lending a sympathetic ear to their plight will help boost the morale of caregivers and attract others...
- 8
- 384
- 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên :
23/06/2014, 01:20
... quite satisfactorily the estimation of N PARTICULAR CASE OF A LINEAR PIECEWISE VARIATION OF THE AUTOCORRELATION MATRIX EIGENVALUES The theoretical validity of this criterion will be demonstrated ... to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation of ... classes An analytical demonstration is provided for a special case of a piecewise linear variation of the autocorrelation matrix eigenvalues Although this model is very simple, it contains all...
- 12
- 409
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
Ngày tải lên :
09/08/2014, 04:20
... was calculated on a leaf area basis by: = where A is the cross-sectional area of the conc ductive pathway and L the leaf area (all sided) of the tree A was measured after the experic ment on the ... shape, and calculating the sap flux as the average of the measurements made at a height of m on a sample of ten trees at Carrasqueira and at a height of 8.5 m on seven We trees at the Bray site The ... temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant during the day...
- 18
- 406
- 0
Báo cáo khoa hoc:" A sampling method for estimating the accuracy of predicted breeding values in genetic evaluation" potx
Ngày tải lên :
09/08/2014, 18:21
... Validation of this method was done in a sub-sample of the data used on the French on-farm evaluation, IBOVAL, for the Parthenaise breed The trait analysed was the muscular development score at ... It was then applied to all the Salers breed animals involved in the French on-farm evaluation of 2000 MATERIALS AND METHODS 2.1 Models Consider a Gaussian mixed linear model with one random factor ... where A is the numerator relationship matrix, and the scalars a and e are the additive and residual variance components, respectively The BLUP (Best Linear Unbiased Prediction) of the breeding values...
- 14
- 295
- 0
Báo cáo y học: "between a chicken and a grape: estimating the number of human genes." pdf
Ngày tải lên :
09/08/2014, 20:21
... their numbers In recent years, as a result of the dramatic breakthroughs in our understanding of RNA interference [7] and miRNAs [8], the number and variety of known RNA genes has grown dramatically, ... scientists across a wide range of fields, who had expected that the number of genes to be a measure of organismal complexity Furthermore, the imprecision of the estimate raised questions about the validity ... RefSeq that either have been manually curated or that have supporting cDNA evidence, and that map onto the current human reference assembly (GRCh37) Another popular resource, the University of California...
- 7
- 378
- 0
Báo cáo khoa hoc:" Applying the Stages of Change model to Type 2 diabetes care in Trinidad: A randomised trial" pptx
Ngày tải lên :
11/08/2014, 07:21
... while there was a simultaneous increase in the number of patients in the action and maintenance stages (collectively) at the end of the study In that publication application of a stage of change model ... UKPDS [12] and an audit described above which provided a mean HbA1c of 8.48% and a standard deviation (S) of the mean of 1.94% gave a sample size of 61 patients in each arm Inclusion and exclusion ... variable The primary outcome variable measured was HbA1c level All HbA1c samples were tested at the same laboratory in the San Fernando hospital, Southwest Regional Health Authority in Trinidad Other...
- 8
- 260
- 0
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx
Ngày tải lên :
13/08/2014, 16:21
... models These models are dual to the centric models [15,16], and they have the same characteristics in terms of realism and computational behavior The fourth class of models, called sub-cellular lattice ... by Graner and Glazier (GG model) [17] Tuning the internal parameters of centric or lattice models is usually achieved by direct comparison of the model output and the real data that they are supposed ... Checkerboard pattern formation was investigated in a simulation study of the sexual maturation of the avian oviduct epithelium [44] Cell sorting is a standard pattern of mixed heterotypic aggregates...
- 13
- 326
- 0
Báo cáo y học: "Estimating the number of children exposed to parental psychiatric disorders through a national health survey" doc
Ngày tải lên :
13/08/2014, 18:21
... below the age of 12 years, was estimated using the survey data The proportion of Canadian children whose parents experience each of the above categories was calculated using the survey parameters ... 16:35-39 Handley C, Farrell GA, Josephs A, Hanke A, Hazelton M: The Tasmanian children's project: the needs of children with a parent/carer with a mental illness Australian and New Zealand Journal of ... the results and analysis and prepared the manuscript All authors read and approved the final manuscript Additional material Additional file Tables This file contains Tables S1, S2 and S3 Click...
- 7
- 420
- 0
Báo cáo y học: " The value of a risk model for early-onset candidemia" ppt
Ngày tải lên :
13/08/2014, 19:20
... have a profound impact on early therapy and intervention in these cases The role of early appropriate therapy has become important as inappropriate or delayed therapy leads to higher mortality [8-10] ... of all bacteremia cases), certain high-risk patients have much higher rates approaching 27% as outlined in this study Risk stratification by application of the validated risk model can have a ... candidemia, studies have show that delayed therapy can lead to a higher mortality in hospitalized patients with late candidemia [11] Early identification of these patients therefore becomes paramount...
- 2
- 304
- 0
Báo cáo y học: " A stochastic model of oncogene expression and the relevance of this model to cancer therapy" ppt
Ngày tải lên :
13/08/2014, 23:20
... other therapies applied such as radiation and/or chemotherapy Table (1) yields theoretical calculations of survival fractions as a function of changes of oncogene expression, differentiation and the ... whether this is a specific feature of Bcr-Abl positive disease or a manifestation of a more general principle of cellular transformation and cancer Namely, does an oncogene act in a similar fashion ... N particular cell population The mathematical relations that we have formulated can quantitatively determine how ablation of an oncogene's protein activity can result in apoptosis and/or a decrease...
- 7
- 297
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
Ngày tải lên :
15/05/2015, 00:37
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation ... compare all median values of larval velocity and activity All significant effects of chemicals on larval locomotion are shown in Figure 3.6 Figure 3.6: Comparative analysis of larval activity Bars...
- 58
- 262
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
Ngày tải lên :
11/09/2015, 14:24
... [19]-[55] The availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite ... resistors and 12 capacitors The ground planes are replaced by the image elements The partial inductance, partial potential coefficient (reciprocal of capacitance) and resistance values are obtained ... typical of the PEEC topology The nodes are separated by the partial inductance L p11 and partial resistance R The excitation and the load currents are I S respectively The partial coefficients of...
- 202
- 532
- 0
The use of credit scoring models and the importance of a credit culture
Ngày tải lên :
04/10/2015, 10:26
... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+ ... D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ BB+ D A B+ BBBB+ BB+ BB BBB+ BB+ BB BBBB+ BB+ BBBBAA A+ BB+ BB CCCB BB CCC B AABBB+ BB+ BB NR/NR/NR Ba2/NR/NR...
- 90
- 917
- 0