The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens doc

The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens doc

Ngày tải lên : 28/06/2014, 17:20
... philosophy were by no means diligent At intervals of assisting us with our translations of Cæsar and the Fables, Master Pierson himself was translating the Greek of Demosthenes' Orations, and also ... minutes, chanting the multiplication tables, the names of the states, the largest cities of the country, or even the Books of the Bible At other times he would throw open the windows and set us shouting ... geras Equi aquatum water the horses agenda sunt It is a very hot = Dies est ingens day æstus Let 's go to the = Jam imus horreum barn Grind the axes = Acuste ascias 10 It is near = Instat hora twelve...
860 461 0
The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens pdf

The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens pdf

Ngày tải lên : 28/06/2014, 17:20
... philosophy were by no means diligent At intervals of assisting us with our translations of Cæsar and the Fables, Master Pierson himself was translating the Greek of Demosthenes' Orations, and also ... minutes, chanting the multiplication tables, the names of the states, the largest cities of the country, or even the Books of the Bible At other times he would throw open the windows and set us shouting ... geras Equi aquatum water the horses agenda sunt It is a very hot = Dies est ingens day æstus Let 's go to the = Jam imus horreum barn Grind the axes = Acuste ascias 10 It is near = Instat hora twelve...
860 304 0
Gender-based Violence and Sexual and Reproductive Health and Rights: Looking at the Health Sector Response in the Asia-Pacific Region doc

Gender-based Violence and Sexual and Reproductive Health and Rights: Looking at the Health Sector Response in the Asia-Pacific Region doc

Ngày tải lên : 05/03/2014, 17:20
... environment to discuss these issues within schools The GEMS approach recognises the importance of going beyond life skills education to question the basic constructs of gender Giving information is not ... were asked to students to assess their support for gender norms Boys and girls in the intervention schools, particularly with classroom sessions, were less supportive of inequitable gender norms, ... risk factors and health consequences from studies across the globe It also provides an assessment of progress and gaps in addressing violence against women globally in the last 15 years Amongst...
16 708 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Ngày tải lên : 07/03/2014, 15:20
... ligands, putative substrate-binding residues and other amino acids situated in the vicinity of these residues The results confirmed the importance of the amino acid residues, all located at the putative ... probably exists as a homodimer under physiological conditions and the dimerization seems to be essential for its hydrolytic activity [15] The protein is proposed to consist of six domains: the N-terminal ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
9 414 0
Báo cáo Y học: Differential scanning calorimetric study of myosin subfragment 1 with tryptic cleavage at the N-terminal region of the heavy chain pdf

Báo cáo Y học: Differential scanning calorimetric study of myosin subfragment 1 with tryptic cleavage at the N-terminal region of the heavy chain pdf

Ngày tải lên : 17/03/2014, 10:20
... myosin classes, this region is either truncated or absent [42] (e.g the entire N-terminal region of more than 70 residues is missing in myosins of class I [43]) As the N-terminal region is proposed ... located near the N-terminal cleavage site in the atomic structure of S1 [28] Comparison of these data suggests that this junction, which also serves as a communication pathway between the Ó FEBS ... actininduced structural changes in the myosin head The main goal of these studies was to understand the mechanism of these changes, i.e the mechanism of transmission of structural changes from the nucleotide-...
11 432 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Ngày tải lên : 31/03/2014, 07:20
... were significantly associated with b2GPI plasma levels (P < 0.0001) In all cases the less common genotypes were associated with lower levels as compared to the homozygous wild type genotypes and the ... genotype) These results are consistent with our findings in plasma samples, i.e although the )1CfiA mutation is associated with lower b2GPI levels, not all b2GPI-deficient samples have this mutation We then ... 4) These results demonstrate a sequencespecific binding of liver nuclear extracts and TFIID to b2GPI sequence at its transcriptional initiation site These results also confirm the location of the...
9 462 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Ngày tải lên : 31/03/2014, 08:20
... It is proposed that combination of the present mutations and mutations at other subsites can accentuate the suppression of activity for shorter substrates and further develop the enzyme specicity ... -SFLDAIVQNGYAFTDRYDIGY VSSEDG SFLDSIIQNGYAFEDRYDLAM SSGDTNYGGMSFLDSFLNNGYAFTDRYDLGF KCPEG KSDGGYAVSSYRDVNP SSIS -FHGYDVVDFYSFKA PTG YGDSPYQSFSAFAGNP DTG SCSSPYNSISSIALNP PTG FGNSPYLCYSALAINP ... Retaining glycoside hydrolases are able to catalyze transglycosylation [3] as depicted in the schematics of the reaction mechanism (Fig 3) Under the present assay Fig Schematics of the double displacement...
14 557 0
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study

assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study

Ngày tải lên : 24/05/2014, 20:32
... As expected, these graphs show, for both materials, the strains under plane stress state are higher than under plane strain The plane stress state also give strain levels higher than what is ... MPa The plane stress state observed at the notch surface change to a three axial stress state inside the component As the stresses observed in one direction present values well below to the values ... of the geometry was used, restricting the nodal dislocations to the nodes on the symmetry lines Analysis considering plane stress state, simulating the surface of the component, and plane strain...
9 410 0
báo cáo hóa học: " Ambulatory monitoring of activity levels of individuals in the sub-acute stage following stroke: a case series" doc

báo cáo hóa học: " Ambulatory monitoring of activity levels of individuals in the sub-acute stage following stroke: a case series" doc

Ngày tải lên : 19/06/2014, 10:20
... this work provides some general insight into activity patterns there has been no research to examine daily activity levels and associated cardiorespiratory responses of patients with stroke at the ... recorder sampled the ECG signal at 200 Hz and the plethysmography signal at 50 Hz Custom software (Matlab, Mathworks, Massachusetts, USA) was used to calculate the heart rate (HR) measure from the ... of the patients reported that wearing the device restricted or otherwise impaired their movements There were no occurrences of system or sensor problems once the system was fitted to the subject...
10 341 0
Current situation of credit activity and solutions to the credit crisis at the military commercial bank the period of 2005 2007

Current situation of credit activity and solutions to the credit crisis at the military commercial bank the period of 2005 2007

Ngày tải lên : 07/08/2014, 10:25
... corporate customers, cash flow and financial ratios, such as debt to total assets ratio, overdue debt to total debt are the keys factors Because the scope of this thesis is corporate customers in ... customers comprising of the customers’ morals and social relationships In terms of businesses, there is massive concern about the competitiveness and reputation of company on the market, as well ... understanding to put their trust in 1.7.3 Assess credit risk There is the indispensible step in order to answer two questions: can customers settle the balance? Moreover, will customers settle the...
53 663 0
Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

Ngày tải lên : 09/08/2014, 14:20
... Similar patterns were found for the presence of asporin in lumbar discs of sand rats Gene expression studies showed greatest expression of asporin in the more degenerate human discs in vivo Asporin ... collagen sponge as previously described [15,16] for weeks, and cultures terminated for harvest of mRNA and immunohistochemistry studies as described above Statistical analyses Standard statistical ... the presence of asporin associated with cells in the outer annulus and, less frequently, with cells in the inner annulus and nucleus pulposus We also found that the asporin gene was expressed in...
7 235 0
báo cáo khoa học: "Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters" ppsx

báo cáo khoa học: "Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters" ppsx

Ngày tải lên : 11/08/2014, 11:21
... it is not possible to compare GUS activity levels between these tissues Therefore GUS activity was measured separately in each of these tissues using a relative scale of to 4, where represents ... suppression of DIR1 expression in these two experiments is due to the high versus low inoculum doses used Collectively, these data suggest that suppression of DIR1 expression occurs through the ... stress response processes [22] The structure of a number of LTPs has been determined revealing that they possess a consensus motif of eight cysteine residues engaged in four disulphide bridges...
16 233 0
báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

Ngày tải lên : 12/08/2014, 01:22
... areas, but this is an issue that should be investigated further Another finding was that DS region residents with skin disease use less oral medication and/or skin cream This might be because their ... cardiovascular disease [6,18] Previous studies assessed the climatic effects of the DS on patients with chronic diseases who came to the region for a short treatment period The present study, in contrast to ... results of previous studies have demonstrated the advantage of the DS region for climatotherapy Most of these studies examined the health benefits of the DS region for patients with chronic diseases...
7 400 0
Báo cáo y học: "Increased plasma levels of the soluble Mer tyrosine kinase receptor in systemic lupus erythematosus relate to disease activity and nephritis" pot

Báo cáo y học: "Increased plasma levels of the soluble Mer tyrosine kinase receptor in systemic lupus erythematosus relate to disease activity and nephritis" pot

Ngày tải lên : 12/08/2014, 15:23
... University Hospital, Sweden The mean age at SLE diagnosis was 35 years and the mean disease duration at the time of the study was 10 years The disease activity was evaluated using SLEDAI-2K (patients having ... and regulation of the immune system, the data suggest that shedding of Mer is an active process in the SLE disease process and that the levels of sMer reflect disease activity Abbreviations ACR: ... SLEDAI score in SLE patients suggesting that the sMer concentrations reflect disease activity rather than disease severity In particular, those patients having nephritis demonstrated increased sMer...
9 372 0
household oriented approach for the optimization of resources management at the floating village in tonle sap lake region, cambodia

household oriented approach for the optimization of resources management at the floating village in tonle sap lake region, cambodia

Ngày tải lên : 09/01/2015, 08:53
... Pur Sat, Battambang Therefore, these towns maybe played the similar roles of domestic waste generation It s also possible to be assumed that the amount of waste generation in zone is approximately ... 2008) SODIS is zero cost option to user, an exception that cost for plastic bottle The estimation of usage SODIS system is approximately US$ 3.15/year per household It is either similar cost to ... cost The purpose of SSF is to remove the turbid water and bacteria that it can cause the diarrheal diseases The benefits of SSF are fast to users, inexpensive, and local material available The...
89 813 0
Some suggestions to improve esp reading cpmprehension skill for students of automotive technology at the central region transport college (CRTC)

Some suggestions to improve esp reading cpmprehension skill for students of automotive technology at the central region transport college (CRTC)

Ngày tải lên : 20/07/2015, 12:26
... discussions) provides the findings and some comments basing on data analysed as well as some suggestions to improve students’ ESP reading comprehension skill Chapter V (Conclusion) summarizes the ... comes to the investigation of ESP reading skill, not other language skills This method is 31 supposed to be of great advantage in the sense that it is easier for the subjects to answer the questions ... respectively) There are some possible reasons for this Firstly, they not know how to find other ESP materials Therefore, it is necessary for the teachers to suggest their students some source of...
104 456 0
Training quality management at the private university of central region of vietnam

Training quality management at the private university of central region of vietnam

Ngày tải lên : 03/09/2015, 13:52
... operate the management system on the basis of standards This system includes the method or processes affects to all phases of the training process for the purpose of management is to create products ... faculty Establishing a system of QM training according to the instructions of the solutions in the thesis Deploying the solution and collect the results for comparison with the previous Assessing the ... employers, alumni The evaluation instruments: student evaluation, curriculum, research and service… QA-processes for specific activities: QA of the studen assessments, the staff, facilities, student...
28 265 0
AN EMPIRICAL INVESTIGATION INTO THE FACTORS CRITICAL TO THE EFFECTIVENESS OF ABS IMPLEMENTATION AT THE NATIONAL AND INTERNATIONAL LEVELS

AN EMPIRICAL INVESTIGATION INTO THE FACTORS CRITICAL TO THE EFFECTIVENESS OF ABS IMPLEMENTATION AT THE NATIONAL AND INTERNATIONAL LEVELS

Ngày tải lên : 02/12/2015, 01:11
... were, these are also presented at the relevant sections in the results There are no interpretative sections within the results section as they simply represent the results as they came from the ... in terms of ABS implementation It then presents the results of the case study structured by the various phases and stakeholders As interviewees were asked what they thought the lessons learnt ... indicators for ABS considers the outcome of various studies that assessed the implementation of ABS instruments at the national level with the aim of identifying whether there are elements that...
363 335 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Ngày tải lên : 26/10/2012, 09:39
... Ang II, a strong vasoconstrictor substance, stimulates mitosis that results in the proliferation of VSMCs and fibroblasts and collagen deposition Ang II is also involved in the initiation and ... the formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats ... environment These cells in the vessel walls are involved in the development of atherosclerosis (6) In the normal vessel walls, GJ plays a very important role in regulating seamless connection (7) The...
8 467 0

Xem thêm