estimating historic activity levels at the region apos s airports

... philosophy were by no means diligent At intervals of assisting us with our translations of Cæsar and the Fables, Master Pierson himself was translating the Greek of Demosthenes' Orations, and also ... minutes, chanting the multiplication tables, the names of the states, the largest cities of the country, or even the Books of the Bible At other times he would throw open the windows and set us shouting ... geras Equi aquatum water the horses agenda sunt It is a very hot = Dies est ingens day æstus Let 's go to the = Jam imus horreum barn Grind the axes = Acuste ascias 10 It is near = Instat hora twelve...

Ngày tải lên: 28/06/2014, 17:20

... philosophy were by no means diligent At intervals of assisting us with our translations of Cæsar and the Fables, Master Pierson himself was translating the Greek of Demosthenes' Orations, and also ... minutes, chanting the multiplication tables, the names of the states, the largest cities of the country, or even the Books of the Bible At other times he would throw open the windows and set us shouting ... geras Equi aquatum water the horses agenda sunt It is a very hot = Dies est ingens day æstus Let 's go to the = Jam imus horreum barn Grind the axes = Acuste ascias 10 It is near = Instat hora twelve...

Ngày tải lên: 28/06/2014, 17:20

Ngày tải lên: 13/02/2014, 16:20

... environment to discuss these issues within schools The GEMS approach recognises the importance of going beyond life skills education to question the basic constructs of gender Giving information is not ... were asked to students to assess their support for gender norms Boys and girls in the intervention schools, particularly with classroom sessions, were less supportive of inequitable gender norms, ... risk factors and health consequences from studies across the globe It also provides an assessment of progress and gaps in addressing violence against women globally in the last 15 years Amongst...

Ngày tải lên: 05/03/2014, 17:20

... ligands, putative substrate-binding residues and other amino acids situated in the vicinity of these residues The results confirmed the importance of the amino acid residues, all located at the putative ... probably exists as a homodimer under physiological conditions and the dimerization seems to be essential for its hydrolytic activity [15] The protein is proposed to consist of six domains: the N-terminal ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...

Ngày tải lên: 07/03/2014, 15:20

... myosin classes, this region is either truncated or absent [42] (e.g the entire N-terminal region of more than 70 residues is missing in myosins of class I [43]) As the N-terminal region is proposed ... located near the N-terminal cleavage site in the atomic structure of S1 [28] Comparison of these data suggests that this junction, which also serves as a communication pathway between the Ó FEBS ... actininduced structural changes in the myosin head The main goal of these studies was to understand the mechanism of these changes, i.e the mechanism of transmission of structural changes from the nucleotide-...

Ngày tải lên: 17/03/2014, 10:20

... were significantly associated with b2GPI plasma levels (P < 0.0001) In all cases the less common genotypes were associated with lower levels as compared to the homozygous wild type genotypes and the ... genotype) These results are consistent with our findings in plasma samples, i.e although the )1CfiA mutation is associated with lower b2GPI levels, not all b2GPI-deficient samples have this mutation We then ... 4) These results demonstrate a sequencespecific binding of liver nuclear extracts and TFIID to b2GPI sequence at its transcriptional initiation site These results also confirm the location of the...

Ngày tải lên: 31/03/2014, 07:20

... It is proposed that combination of the present mutations and mutations at other subsites can accentuate the suppression of activity for shorter substrates and further develop the enzyme specicity ... -SFLDAIVQNGYAFTDRYDIGY VSSEDG SFLDSIIQNGYAFEDRYDLAM SSGDTNYGGMSFLDSFLNNGYAFTDRYDLGF KCPEG KSDGGYAVSSYRDVNP SSIS -FHGYDVVDFYSFKA PTG YGDSPYQSFSAFAGNP DTG SCSSPYNSISSIALNP PTG FGNSPYLCYSALAINP ... Retaining glycoside hydrolases are able to catalyze transglycosylation [3] as depicted in the schematics of the reaction mechanism (Fig 3) Under the present assay Fig Schematics of the double displacement...

Ngày tải lên: 31/03/2014, 08:20

... As expected, these graphs show, for both materials, the strains under plane stress state are higher than under plane strain The plane stress state also give strain levels higher than what is ... MPa The plane stress state observed at the notch surface change to a three axial stress state inside the component As the stresses observed in one direction present values well below to the values ... of the geometry was used, restricting the nodal dislocations to the nodes on the symmetry lines Analysis considering plane stress state, simulating the surface of the component, and plane strain...

Ngày tải lên: 24/05/2014, 20:32

... this work provides some general insight into activity patterns there has been no research to examine daily activity levels and associated cardiorespiratory responses of patients with stroke at the ... recorder sampled the ECG signal at 200 Hz and the plethysmography signal at 50 Hz Custom software (Matlab, Mathworks, Massachusetts, USA) was used to calculate the heart rate (HR) measure from the ... of the patients reported that wearing the device restricted or otherwise impaired their movements There were no occurrences of system or sensor problems once the system was fitted to the subject...

Ngày tải lên: 19/06/2014, 10:20

... corporate customers, cash flow and financial ratios, such as debt to total assets ratio, overdue debt to total debt are the keys factors Because the scope of this thesis is corporate customers in ... customers comprising of the customers’ morals and social relationships In terms of businesses, there is massive concern about the competitiveness and reputation of company on the market, as well ... understanding to put their trust in 1.7.3 Assess credit risk There is the indispensible step in order to answer two questions: can customers settle the balance? Moreover, will customers settle the...

Ngày tải lên: 07/08/2014, 10:25

... Similar patterns were found for the presence of asporin in lumbar discs of sand rats Gene expression studies showed greatest expression of asporin in the more degenerate human discs in vivo Asporin ... collagen sponge as previously described [15,16] for weeks, and cultures terminated for harvest of mRNA and immunohistochemistry studies as described above Statistical analyses Standard statistical ... the presence of asporin associated with cells in the outer annulus and, less frequently, with cells in the inner annulus and nucleus pulposus We also found that the asporin gene was expressed in...

Ngày tải lên: 09/08/2014, 14:20

... it is not possible to compare GUS activity levels between these tissues Therefore GUS activity was measured separately in each of these tissues using a relative scale of to 4, where represents ... suppression of DIR1 expression in these two experiments is due to the high versus low inoculum doses used Collectively, these data suggest that suppression of DIR1 expression occurs through the ... stress response processes [22] The structure of a number of LTPs has been determined revealing that they possess a consensus motif of eight cysteine residues engaged in four disulphide bridges...

Ngày tải lên: 11/08/2014, 11:21

... areas, but this is an issue that should be investigated further Another finding was that DS region residents with skin disease use less oral medication and/or skin cream This might be because their ... cardiovascular disease [6,18] Previous studies assessed the climatic effects of the DS on patients with chronic diseases who came to the region for a short treatment period The present study, in contrast to ... results of previous studies have demonstrated the advantage of the DS region for climatotherapy Most of these studies examined the health benefits of the DS region for patients with chronic diseases...

Ngày tải lên: 12/08/2014, 01:22

... University Hospital, Sweden The mean age at SLE diagnosis was 35 years and the mean disease duration at the time of the study was 10 years The disease activity was evaluated using SLEDAI-2K (patients having ... and regulation of the immune system, the data suggest that shedding of Mer is an active process in the SLE disease process and that the levels of sMer reflect disease activity Abbreviations ACR: ... SLEDAI score in SLE patients suggesting that the sMer concentrations reflect disease activity rather than disease severity In particular, those patients having nephritis demonstrated increased sMer...

Ngày tải lên: 12/08/2014, 15:23

... Pur Sat, Battambang Therefore, these towns maybe played the similar roles of domestic waste generation It s also possible to be assumed that the amount of waste generation in zone is approximately ... 2008) SODIS is zero cost option to user, an exception that cost for plastic bottle The estimation of usage SODIS system is approximately US$ 3.15/year per household It is either similar cost to ... cost The purpose of SSF is to remove the turbid water and bacteria that it can cause the diarrheal diseases The benefits of SSF are fast to users, inexpensive, and local material available The...

Ngày tải lên: 09/01/2015, 08:53

... discussions) provides the findings and some comments basing on data analysed as well as some suggestions to improve students’ ESP reading comprehension skill Chapter V (Conclusion) summarizes the ... comes to the investigation of ESP reading skill, not other language skills This method is 31 supposed to be of great advantage in the sense that it is easier for the subjects to answer the questions ... respectively) There are some possible reasons for this Firstly, they not know how to find other ESP materials Therefore, it is necessary for the teachers to suggest their students some source of...

Ngày tải lên: 20/07/2015, 12:26

... operate the management system on the basis of standards This system includes the method or processes affects to all phases of the training process for the purpose of management is to create products ... faculty Establishing a system of QM training according to the instructions of the solutions in the thesis Deploying the solution and collect the results for comparison with the previous Assessing the ... employers, alumni The evaluation instruments: student evaluation, curriculum, research and service… QA-processes for specific activities: QA of the studen assessments, the staff, facilities, student...

Ngày tải lên: 03/09/2015, 13:52

... were, these are also presented at the relevant sections in the results There are no interpretative sections within the results section as they simply represent the results as they came from the ... in terms of ABS implementation It then presents the results of the case study structured by the various phases and stakeholders As interviewees were asked what they thought the lessons learnt ... indicators for ABS considers the outcome of various studies that assessed the implementation of ABS instruments at the national level with the aim of identifying whether there are elements that...

Ngày tải lên: 02/12/2015, 01:11

... Ang II, a strong vasoconstrictor substance, stimulates mitosis that results in the proliferation of VSMCs and fibroblasts and collagen deposition Ang II is also involved in the initiation and ... the formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats ... environment These cells in the vessel walls are involved in the development of atherosclerosis (6) In the normal vessel walls, GJ plays a very important role in regulating seamless connection (7) The...

Ngày tải lên: 26/10/2012, 09:39