establish a security management structure and clearly assign security resp
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... chorismate mutase by combinatorial mutagenesis and selection: the importance of electrostatic catalysis Proc Natl Acad Sci USA 93, 5043–5048 11 Haslam, E (1993) Shikimic Acid: Metabolism and Metabolites ... mutase from B subtilis is a homotrimer and adopts a pseudo -a/ b barrel fold [38] A transition state analog, shown in a ball -and- stick representation, is bound in each of the active sites, which are...
- 8
- 635
- 0
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach ... (TP), medial malleolus (M) and tendo Achilles (TA) Small arrow indicates rounded TP tendon proximally and large arrow indicates the flattened area of tendon in retromalleolar region as a result ... walking is based on relatively small sample sizes and is limited to only adult and older adult participants Despite the absence of normative data, other studies have investigated TP EMG activation...
- 8
- 530
- 0
Data Security Policy - Structure and Guidelines
... and customer data s To educate users and vendors about their obligation for protection all data assets To establish the baseline data security stance and classification ... Operations and Systems Administration organizations must ensure that adequate logs and audit trails are kept of all data access s The Data Security, Network Operations and Systems Administration organizations ... development and deployment 21 System, application, and configuration management a Assurance b Patch management 22 Infrastructure security a Intrusion detection b System hardening Sample Data Security...
- 20
- 586
- 2
Sockets and Services from a Security Point of View
... mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration information ... can, maintain web page usernames and passwords separately from operating system usernames and passwords Log web access, and look for unusual patterns (excessive 404 errors, etc.) Security characteristics ... paying attention to details like available hard disk space, network bandwidth, and so on Install a server−based virus scanner to sanitize e−mail attachments as well Security characteristics of the...
- 21
- 587
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) ... neurons, the A1 0L rons from rat intracardiac ganglia, which are believed to mutation in PnIA again caused an increase in potency as arise primarily from a3 b2 and a3 b4 nAChRs Activity on well as a shift ... oocyte-expressed human nAChR subunit combinabrain [64] and has proven to be a powerful radioligand in tions and seems to have a similar selectivity and activity as numerous binding and autoradiography studies...
- 15
- 757
- 0
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt
... of a typical risk management policy Board mandate and commitment Many organisations issue an updated version of their risk management policy each year This ensures that the overall risk management ... identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes Effects Analysis are quantitative technical failure analysis techniques ... developed into a set of targets for health and safety performance There is a danger that risk appetite statements fail to be dynamic, and they can constrain behaviour and rapid response At Board level,...
- 20
- 818
- 1
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... measured at room temperature ROA data originating in artefacts from buer bands have been cut out in some places Fig The backscattered Raman and ROA spectra of recombinant human wild-type tau46 ... backscattered Raman and ROA spectra of the wild-type and mutant tau46 are shown as the top and bottom pairs, respectively, in Fig Both ROA spectra show a strong positive ROA band centred at » 1316± ... contain substantial amounts of the PPII helical conformation (see below), these b- and jcasein ROA bands are therefore assigned to PPII structure The positive ROA bands in b- and j-casein at »...
- 9
- 667
- 0
Making monitoring and evaluation systerms work a capacity development toolkitInteractive textbook at www/worldbank.org/pdt1. Structure and Organizational Alignment for M&E pptx
... of each c) Develop a national evaluation and research strategy d) Ensure that research and evaluations are done in an ethical way e) Develop and/ or update a national evaluation and research agenda ... of sampling Six routine data Data sourcing, data collection, data collation, data management analysis, data reporting, and data use processes SPSS Statistical Package for Social Sciences SQL Structured ... disseminated 428 Implement standard data management processes as part of a performance management system 429 Quality assurance during all steps of M&E design and data management 429 5.6 Defining and...
- 530
- 2,030
- 0
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... (Nv) and Adamsia carciniopados (Ac), the taipan snake Oxyuranus scutellatus (Os), and the boar Sus scrofa (Ss) Identical residues are on a black background, and similar residues are on a gray background ... PLA2s than UcPLA2 (Fig 3A) Other known cnidarian PLA2s, such as those from the hydrozoan Hydra magnipapillata [34] and the sea anemones A pallida [16,17] and B caissarum [19], as well as the PLA2 ... UcPLA2 and AtxC in the bath were 3.2 and 0.28 lm, respectively Data mining and phylogenetic analysis All database searches were performed online and were completed in January 2009 The databases analyzed...
- 13
- 462
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... aureus EF-G structure The mutation sites are displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... and Crystal structure of Staphylococcus aureus EF-G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the...
- 15
- 474
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, ... Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... characteristics of transthyretins and TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled...
- 13
- 390
- 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx
... ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT TGCTAGAGATTTTCCACAT TGACAAGGATGGCTGGTGGGACTTAGCGTA ... TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC ... TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC of the archaeal FEN-1 homologues have assisted...
- 14
- 433
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six ... 48.67 A, b ¼ 74.38 A, c ¼ 64.18 A and ˚ resolution b ¼ 108.6°, and diffracted to at least 1.5 A Crystal data and data collection statistics are summarized in Table Calculation of the Matthews ... 4-MU-(GlcNAc)3, as also earlier demonstrated by Saito et al [21] On the other hand, ChiG showed activity against a- chitin and b-chitin (supplementary Fig S2), chitooligosaccharides (Figs and 3), carboxymethyl-chitin–remazol–brilliant...
- 12
- 399
- 0
INFORMATION TECHNOLOGY INVESTMENT MANAGEMENT: A Framework for Assessing and Improving Process Maturity pot
... practices and attributes, such as strategic planning, project management, enterprise architecture (EA) management, human capital management, and software and system acquisition management In May 2000 ... acquisition management, • human capital management, • information security management, and • enterprise architecture management Using the results of this research and evaluation, we have developed various ... improvement in a variety of ways For example, an organization can create a separate improvement program, employ external assistance and support, or use the framework as a managerial support tool Regardless...
- 142
- 2,194
- 0
Báo cáo khoa học: "A UNIFIED MANAGEMENT AND PROCESSING OF WORD-FORMS, IDIOMS AND ANALYTICAL COMPOUNDS" ppt
... interested reader may find all the necessary details in Tufts and Popescu (199 0a) and Tufts and Popescu (1990b) Yet, we have to say that the proper morpho-lexical processings (analysis and generation), ... possibilities and standard linking interfaces for three main types of applications: advanced text-editing, language-learning and machine translation (including NL interfaces) With respect to spelling ... automatically classified during the learning (acquisition) phase (Tufis 1990) into an inheritance hierarchy A compilation phase transforms this hierarchy into the paradigms table The internally assigned...
- 6
- 431
- 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA sequencing on Applied Biosystems Sequencer 37 3A ... 188–122) A large difference is centred on Met121 In particular, the mean B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms ... caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and carboxy content suggests that the modified residue is also methionine, and...
- 9
- 556
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... 1–17 and 24–34 by daN and dNN cross-peaks As an a- helical secondary structure was assumed from chemical-shift arguments, daN(i,i+3) and daN(i,i+4) NOE cross-peaks were used, leading to the assignment ... indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared ... Diego, CA, USA) Signal overlap in the 800-MHz NOESY made peak integration unreliable So, instead, signal height of the cross-peaks was used for a conservative estimation of the maximum distances and...
- 10
- 426
- 0
Electronic structure and magneto optical properties of solids v antonov, b harmon, a yaresko
... occupied and empty valence states, x-ray excitations have the advantage that the core state has a purely local wave function, which offers site, symmetry, and element specificity XMCD enables a quantitative ... normal LSD calculation and λσ are Lagrange parameters ij The SIC removes unphysical self-interaction for occupied electron states and decreases occupied orbital energies Calculations for atoms have ... LDA+U calculations with PES or optical spectra While the use of an adjustable parameter is generally considered an anathema among first principles practitioners, the LDA+U approach does offer a...
- 545
- 509
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008