eric brill and robert c moore

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... Sci. 2006, 3 60 6. Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) HBV and HCV infections are confirmed causes of HCC. What’s the combined effect of HBV and HCV coinfection ... coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC. A case-control study [51] conducted in Qidong county ... HBV and HCV dual infection, whether HBV on HCV or HCV on HBV, are characterized by a severe clinical and histological presentation. Occult HBV Infection in Patients with HCV Infection Occult...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright

Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright

... a customized prescription for new contact lenses to correct her vision. customization: tailoring service characteristics to meet each customer's specific needs and preferences. standardization: ... user-friendly and offer customers greater convenience. Balancing Demand and Capacity In general, services that process people and physical objects are more likely to face capacity limitations ... UNDERSTANDING SERVICES The four-way classification scheme in this chapter focuses on different types of service processes. Some services require direct physical contact with customers (hair- cutting...

Ngày tải lên: 07/02/2013, 09:52

387 1,2K 6
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

... fluorescence; F m , maximal fluorescence; F v , variable fluorescence; FI, fluorescence induction; NPQ, nonphotochemical quenching; PQ, plastoquinone; PS, photosystem; Q A and Q B , primary and secondary ... (1989) Determination of accurate extinction coefficients and simultaneous-equations for assaying chlorophyll-a and chlorophyll-b extracted with 4 different solvents ) verifi- cation of the concentration of chlorophyll ... thus reflecting the sequential reduction of the acceptor side compo- nents of PSII, but the characteristics of each phase, such as its rate constant, cannot be assessed. Although this approach is...

Ngày tải lên: 19/02/2014, 05:20

8 712 0
Tài liệu How To Close every sale By Joe Girard and roBerT l. sHook ppt

Tài liệu How To Close every sale By Joe Girard and roBerT l. sHook ppt

... prospect join the callback club A callback club is a non-exclusive club of prospects who say that they will callback aer thinking it over. A good salesperson does not give the pros- pect a chance ... sales success. • Conviction gives you power. It’s crucial that you thoroughly believe in your product or service. e conviction of absolute certainty in your product will give you condence as ... example, walk the customer through the oce space and walls lined with framed pic- tures of citations, newspapers and articles, etc. acknowledging your rm’s accomplishments and good reputation. Bring...

Ngày tải lên: 19/02/2014, 10:20

7 470 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... PKCa in VSMC. From these results, we concluded that the enhan- cing effect of LPS/IFN-induced NO production was caused by upregulation of PKC in VSMC. Keywords: a-tocopheryl hemisuccunate; a-tocopherol; ... tumor necrosis factor receptor; TS, a-tocopheryl hemisuccinate; VSMC, vascular smooth muscle cells. Enzymes: nitric oxide synthase (EC 1.14.13.39); protein kinase (EC 2.7.1.37). (Received 11 December ... kB-dependent mechanism. J. Immunol. 161, 6206– 6214. 31. Chen, C C., Chiu, K T., Sun, Y T. & Chen, W C. (1999) Role of the cyclic AMP-protein kinase a pathway in lipopolysaccharide- induced nitric oxide...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Data Structures and Algorithms – C++ Implementation ppt

Data Structures and Algorithms – C++ Implementation ppt

... Computer Science and Engineering – HCMUT recycled After pPre - > link = pLoc - > link recycle (pLoc) 2 count head list 39 75 pLocpPre Linked Lists  A linked list is an ordered collection ... null list.count = 0 ? ? count head list Slide 21Faculty of Computer Science and Engineering – HCMUT 0 count head After list list.count = 0 Data Structures and Algorithms – C+ + Implementation Ho Chi ... &pLoc){ pPre = NULL; pLoc = this->head; while (pLoc != NULL && pLoc->data != value){ Slide 40Faculty of Computer Science and Engineering – HCMUT pPre = pLoc; pLoc = pLoc->next; } return...

Ngày tải lên: 06/03/2014, 17:20

53 674 2
THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc

THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc

... Ex- plorations ofComputing as a Social Practice. Greenwich, CT: Ablex American Anthropological Association. 1998. Code of Ethics of the American Anthropo- logical Association. http://www.aaanet.org/ committees/ethics/ethcode.htm Anderson ... and culture (Ruby 2000)—methods and con- cepts which they increasing employ—leading to a focus instead on dichotomies of hegemony and resistance, production and reception, and of mass media and AR ... Desire and Tech- nology at the Close of the Mechanical Age. Cambridge, MA: MIT Thomas J. 1996. Introduction: a debate about the ethics of fair practices in collecting social science data in cyberspace....

Ngày tải lên: 06/03/2014, 21:20

19 659 1
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

... 5¢-ATGAGAG AGGTTATCAGCATC-3¢ and 5¢-TTAGTACTCGTCAC CATAGCC-3¢; for TgDRE, 34S13 sens: 5¢-ATGCTGGA CTCTCTCTACGGGGAT-3¢ and 34AS15 antisens: 5¢-TT AGTCGAGGGGTTTGTCTGC-3¢. PCR products were electrophoresed ... Amplification Kit (Clontech) with the adaptor primer 2 and speci c oligonu- cleotides N34AS 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for 3¢ RACE. Nested PCR was ... oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and PR2AS 5¢-GACCGTTACCACTGATTGCGGCTG 3¢ for 3¢ RACE. The PCR products were cloned into the TA cloning vector (Invitrogen) which...

Ngày tải lên: 08/03/2014, 22:20

9 421 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ... constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, ... of pcerulean-elongin C. pCerulean (W66A) -C1 was constructed by site-directed mutagenesis, using the primers 5¢-CGTGACCACCCTGACCGCGGG CGTGCAGTGCTTC-3¢ and 5¢-GAAGCACTGCACGCC CGCGGTCAGGGTGGTCACG-3¢....

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc

Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc

... internal calcium concentration, which in turn activates the uniporter of calcium, increasing even more the calcium influx and ROS production. Both the increase of intramitochond- rial calcium concentration ... swelling and permeability changes of mito- chondria induced by MccJ25, we tested the influence of the speci c pore inhibitor cyclosporin A (CsA), a calcium chelator (EDTA), a calcium competitor (Mn 2+ ) ... mitochondrial swelling as a function of MccJ25 concentration. Table 1. Effect of different drugs on the swelling and calcein release from mitochondria induced by MccJ25. Swelling and calcein release...

Ngày tải lên: 16/03/2014, 06:20

9 286 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

... DS in the case of chondroitin ABC lyase (EC 4.2.2.4), whereas chondroitin AC lyases act on CS alone. Chondroitin AC and ABC lyases generate disac- charides and tetrasaccharides [4] and have been ... capping sequences of speci- c structure, and further studies of speci c oligosac- charides from CS⁄ DS chains are required to enhance our understanding of the biological activities of CS and DS. Experimental ... Reaction of unsaturated uronic acid residues with mercuric salts. Cleavage of the hyaluronic acid disaccharide 2-acetamido-2-deoxy-3-O -(beta- d-gluco- 4-enepyranosyluronic acid)-d-glucose. Biochem...

Ngày tải lên: 16/03/2014, 14:20

11 481 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... cigr@nmr.mpibpc.mpg.de Abbreviations: SP -C, surfactant-associated protein C; hSP -C, human SP -C; pSP -C, porcine SP -C; rSP -C, recombinant human SP -C; rSP -C (FFI), FFI variant of recombinant human SP -C; TACSY, ... rSP -C (FFI) mutant in CDCl 3 /CD 3 OH (1 : 1, v/v) with a comparison with the structure of pSP -C. A second set of C- terminal signals is explained by the coexistence of monomeric and oligomeric ... NN (i,i+1) connectivities clearly show the a-helical structure of rSP -C (FFI). In addition, 3 J NHa coupling constants are summarized, with small circles indicating couplings < 5.0 Hz and large circles...

Ngày tải lên: 16/03/2014, 16:20

10 426 0
Developing and Porting C and C++ Applications on Aix pdf

Developing and Porting C and C++ Applications on Aix pdf

... countries. SET and the SET Logo are trademarks owned by SET Secure Electronic Transaction LLC. Other company, product and service names may be trademarks or service marks of others. Chapter 1. C and C+ + compilers ... between a process and a user thread . . . . . . . . . . . . 276 xii Developing and Porting C and C+ + Applications on AIX Chapter 1. C and C+ + compilers 23 1.4 Activating the compilers Once you have ... licensed product supplies a simple nodelock license certificate. Both the C for AIX Version 6.0 and VisualAge C+ + for AIX Version 6.0 compiler products supply a simple nodelock license certificate. The...

Ngày tải lên: 17/03/2014, 13:20

546 2,6K 0
C#1 introduction to programming and the c language potx

C#1 introduction to programming and the c language potx

... output. Exam05 Perimeter and area of a circle As an example I will show an application, where the user must enter the radius of a circle, and the program calculates and writes the circle’s circumference and area. ... to C# A computer program is a family of commands executed in a speci c order that together solves a speci c task. A program is written as a text document that contains all the necessary commands. ... + b * c b * c is calculated rst, since * has higher precedence than +. If instead you writes (a + b) * c a + b are rst calculated as parentheses have higher precedence than *. In most cases...

Ngày tải lên: 18/03/2014, 02:20

30 539 0

Bạn có muốn tìm thêm với từ khóa:

w