equations of the form y b k t n m ••••••••••••••••••••••

Tài liệu Báo cáo Y học: Puriﬁcation, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Ngày tải lên : 22/02/2014, 07:20

... activity of the enzyme was measured by the dinitrosalicylic acid method Inhibition of the enzyme activity by glucose, maltose and cyclohexaamylose For the study of the enzyme inhibition by glucose, ... of the Betamyl b- amylase test reagent from Megazyme was strongly inhibited by glucose and maltose At a concentration of 125 mM both sugars reduced the activity of the b- amylase with 87.5% Mannose ... cyclohexaamylose (Ki ¼ 0.36 mM ) Northern blot analysis was performed to determine the total length of the mRNA encoding the b- amylase Hybridization of the blot using the random primer labeled cDNA...

11
611
0

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20

... suggest that in vitro the secondary structure of Ab is strongly dependent on experimental conditions This is a typical feature of small and medium size peptides, but in the case of Ab the conformational ... assignment was performed However, the analysis of NOESY spectra evidenced only the presence of sequential, short-range contacts, suggesting the absence of any preferential conformation In the end, ... has been evidenced By contrast, it has been proposed that HA_fd inserts both helical stretches into the membrane [38] Accordingly, it is possible that the mechanism of membrane interaction and...

7
624
0

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Ngày tải lên : 08/03/2014, 23:20

... protonated and the deprotonated state The PCR fragment containing the mutation N3 73D was constructed in a two-step protocol For the PCR fragment encoding the N- terminal part of the b subunit, primers ... Construction of mutant N3 73D and double mutant N3 73D/D20 3N in the b subunit Fig Topology model of the b subunit emphasizing functionally important amino-acid residues proposed to insert into the ... (Km % mM) was dramatically affected by the S382A mutation We also investigated the stability of OadB with the S382A mutation in the presence of trypsin This mutant enzyme was degraded by trypsin...

8
508
0

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

Ngày tải lên : 24/03/2014, 03:21

... FAE1 KCS is anchored to the membrane by its transmembrane domains, and the region beyond the transmembrane domains constitutes the globular portion of this enzyme Elongation of acyl substrates by ... cysteine forming an acyl thioester intermediate, decarboxylation of the donor malonyl substrate to yield an acetyl carbanion intermediate, and ﬁnally, nucleophilic attack of the carbanion on the ... characterization of the mutants of the putative catalytic triad strongly support the hypothesis that the membrane-bound FAE1 KCS shares the same basic mechanism with the soluble condensing enzymes Additional...

9
457
0

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Ngày tải lên : 24/03/2014, 03:21

... interaction between the CaM-binding domain and the CnBbinding helix and increases the afﬁnity of the CaM-binding domain for Ca2+/CaM [25,26] The regulation of the CaMbinding domain by CnB may partly account ... likely contribute to differences in their inhibitory potency As the substrate-binding cleft geometry is affected by CnB, the interaction between CnA and CnB may affect how the FKBP12/FK506 and CyPA/CsA ... structurally unrelated immunophilin/immunosuppressant complexes of FKBP12/FK506 or CypA/CsA inhibit CaN noncompetitively by binding to the CnB-binding helix, CnB, and one side of the substrate-binding...

9
473
0

Báo cáo y học: "Characterization of the human endogenous retrovirus K Gag protein: identification of protease cleavage sites" ppt

Ngày tải lên : 13/08/2014, 01:20

... 8:21 http://www.retrovirology.com/content/8/1/21 Page of Table Summary of the peptide fragments obtained by MS analysis Gag domains Peptides found by MS analysis (AA position) Matrix 31STKNLIKLFQIIEQFCPWFPEQGTLDLK58 ... HERV -K Gag corresponding to peptide sequences obtained by MS of 2-D separated A proteins Table gives a summary of the peptide fragments obtained by MS analysis The mass spectrometry did not allow ... myristoylated head, which usually directs Gag to cell membranes At the C-terminus are two Zink-finger motifs, suggesting the location of the nucleocapsid (NC) protein The NC binds RNA and enables the...

8
208
0

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20

... AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time GCTTCTTCCTCCTCGCTGTC Real-time TGCACTCTTTGTCTTCCTGTCG Real-time CGGTAGTCAGGAAATCAATGC ... transcription factors and the cytokine genes known to be produced by different T- cell subtypes in mammals These transcription factors, together with many of the important cytokines that are expressed ... to note that not all the cytokines known in mammals have been found in ﬁsh, and it remains to be determined whether the regulation of adaptive immunity in ﬁsh is similar to that found in mammals,...

20
689
0

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Ngày tải lên : 19/02/2014, 05:20

... afﬁnity, not for PE-containing membranes, but rather for anionic membranes containing PG [16], and little information is available regarding the phospholipid and membrane binding of the other members ... the putative functions of PEBPs, except for CPY inhibition by IC [8], remain obscure In the present study, we report on a detailed study of the membrane-binding mode of IC, a PEBP family member ... properties of IC In an attempt to detect and characterize the membrane binding of IC, a member of the PEBP family, we ﬁrst performed a liposome-binding assay of this inhibitor for the phosphatidylcholine...

10
645
1

Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

Ngày tải lên : 08/03/2014, 23:20

... out both the iron-oxidation and the iron-mineralization process In the mammalian proteins, these two reactions are carried out by two distinct chains The stability of the T bernacchii homopolymer ... protein than to the L-type one [21] This behavior may be attributed at least in part to the absence of the salt bridge formed within the four-helix bundle of the L chains between K6 2 and E107 and ... corrected for the solvent contribution at the different temperatures and pH values examined The melting temperatures were determined by taking the ﬁrst derivative of the ellipticity signal at 222 nm...

7
609
0

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

Ngày tải lên : 16/03/2014, 14:20

... rebinding with dimer to the total protein oxygenation must be taken into account and the effect of NaCl concentration on the rates of O2 binding to the a and b subunits within the dimer must be ... significant functional heterogeneity for the a and b subunits in the last ligandbinding step (Table 2) The change in the total protein affinity to oxygen is derived from the rate constant and quantum yield ... closer to the iron atom and its ability to lower the ligand affinity In this study, different NaCl effects on the association rate constant and the quantum yield of BR (the efficiency of the ligand...

11
577
0

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the ﬁsh pathogen Francisella victoria ppt

Ngày tải lên : 30/03/2014, 10:20

... they have been shown to be immuno-stimulatory, whereas at higher concentrations they can be immuno-inhibitory [20,21] and seem to modulate the release of potent cytokines induced by LPS Possibly ... lactam formation MS ⁄ MS experiments led to the observation of a signal at m ⁄ z 199.2, corresponding to a cyclic AA component The cyclic structure of the AA was conﬁrmed by the observation of the ... performed with support from Canadian Bacterial Diseases Network The NMR spectra at 800 MHz were obtained at the Varian Unity Inova spectrometer of the Danish Instrument Center for NMR Spectroscopy...

12
397
0

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Ngày tải lên : 31/03/2014, 09:20

... short N- terminal intracytoplasmic domain, a transmembrane domain followed by a stem region and a catalytic domain, the latter domain presenting the highest identity among the four sequences Of note, ... method from the sequences listed in Table The scale bar represents the number of substitutions per site for a unit branch length Determination of the enzyme activity rat enzyme presents a short ... ﬂuorescence intensities are plotted against cell numbers Negative controls were performed in absence of primary antibody by the anti -B reagent, suggesting that the new rat gene encodes an enzyme with...

8
499
0

cognitive psychology in and out of the lab. 4th ed. - k. galotti (wadsworth, 2008)

Ngày tải lên : 12/05/2014, 17:34

... extensive comments on one or more chapters in one of the editions The remaining gaps and shortcomings in the book reflect my own stubbornness Kathleen M Galotti xix This page intentionally left ... attention, mentally focusing on some stimulus (the mysterious shape); perception, interpreting sensory information to yield meaningful information; and pattern recognition, classifying a stimulus ... longer than the other he removed from the end, thus obtaining the same length: “Are they the same?—Yes.—Exactly?—Yes.— (The elements of the model were then put further apart, and the in his copy...

705
1.4K
0

Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

Ngày tải lên : 07/08/2014, 06:20

... also note that from the definition of a b- trie we have hk = for n > b2 k and hk = for n n ≤ n ≤ b, k ≥ The asymptotic formula for hk in the matching region between (b) and (c) may be n obtained by ... cases in Theorem is better understood by viewing the problem as first fixing k and b, and then varying n (cf Section 4) Theorem For b → ∞ the distribution of the height of b- tries has the following ... assume that every symbol is equally likely, thus the strings are emitted by an unbiased memoryless source Our interest lies in establishing the asymptotic distribution of the height, which is the...

16
351
0

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Ngày tải lên : 09/08/2014, 04:20

... concomitant with the advent of the N activity, indicates a relationship ase between both enzyme activities The low NR activity (!1 nmol N0 DW!h-!) of -mg2 nodulated plants could be greatly increased ... Effect of nitrate of leaf NR activity of nodulafed plants Administration of mM NaN0 to 11 mo old nodulated plants did not increase leaf NR activity, whereas the 10 mM NaN0 dose induced high enzyme ... expanded, the NR activity decreased in the previous leaf and the highest enzyme activity was found again in the new leaf (Fig 2) When the nitrate supply was withdrawn, the enzyme activity recovered its...

4
202
0

báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

Ngày tải lên : 11/08/2014, 18:20

... dislocation, in the form of ostracism, excommunication, exile, and solitary confinement, has been a dreaded punishment from ancient times until the present " http://www.harmreductionjournal.com/content/6/1/12 ... even if they are not materially poor Neither food, nor shelter, nor the attainment of wealth can restore them to well-being Only psychosocial integration itself can that In contrast to material ... the continuum where addicted people "strive to maintain a double life" and the appearance of normality, to the severe end when the addiction cannot be concealed, destroys the person's conventional...

4
220
0

Transcriptional regulation of the inducible costimulator (ICOS) in t cells

Ngày tải lên : 13/09/2015, 19:52

... luciferase MAPK mitogen-activated protein kinase MHC major histocompatibility complex MOG myelin oligodendrocyte glycoprotein mTOR mammalian target of rapamycin NFAT nuclear factor of activated T cells ... cell; M = macrophage; ITAM = immunoreceptor tyrosine-based activation motif; ITIM = immunoreceptor tyrosine-based inhibition motif; ITSM = immunoreceptor tyrosine-switch motif domains Four cysteine ... compromised in the absence of Lck, but hardly impaired by the absence of Fyn Interestingly, more profound defects in the Lck-dependent signalling pathway were observed with stimulation of Fyndeficient...

151
307
0

The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

Ngày tải lên : 28/06/2014, 19:20

... economic conditions of the country, a strike on the part of the workmen in one industry means that all the workmen in that industry stop work; and, as trade is usually in a state of congestion, ... largely to the division and conflict of authority The management is separated from its central board, not only by the Atlantic, but by the local board sitting in Buenos Aires And, although on the ... permanent.] Because of this concentration of business in the capital, and in the centre of the town in particular, rents have risen to an immense extent, greatly increasing all establishment charges,...

199
354
0

T.H MaTrận Đề K.T: N.Văn THCS Phần 3

Ngày tải lên : 11/05/2015, 10:00

... cỏc bi hc khỏc + Chỳ trng hỡnh thnh, ph t trin v hon thin c k nng nghe, n i, c, vit c bit l qua k nng ny hỡnh thnh nng lc cm th, nng lc bc l, biu t t tng, t nh cm bng ng n ng n i, vit ting Vit ... i mi PPDH v KT-G, r n luyn k nng, k thut dy hc (trong ú cú k nng ng dng CNTT, khai thỏc internet), t ch ly h s chuy n m n, to c uy t n chuy n m n th GV v HS, khụng ngng n ng cao trỡnh cỏc lnh ... phong tro thi ua sụi ni ch nhm thc hin mt chin dch mt thi gian nht nh i mi KT-G l mt hot ng thc tin chuy n m n cú t nh khoa hc cao nh trng, cho n n phi ng thi n ng cao nhn thc, b sung kin thc, trang...

149
270
0

Mỗi ngày 10 phút làm đẹp

Ngày tải lên : 27/09/2015, 02:03

1
155
0