equations of the form y b g x t y •••••••••••••••

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... dinitrosalicylic acid method Inhibition of < /b> the < /b> enzyme activity by glucose, maltose and cyclohexaamylose For the < /b> study of < /b> the < /b> enzyme inhibition by glucose, maltose and cyclohexaamylose b- amylase ... all other plant b- amylases including the < /b> C sepium b- amylase Studies of < /b> the < /b> crystal structure of < /b> recombinant soybean b- amylase complexed to b- cyclodextrin demonstrated the < /b> role of < /b> Glu186 and Glu380 ... at pH values below and above 12 irreversibly inactivated the < /b> protein Hydrolysis of < /b> the < /b> Betamyl b- amylase test reagent from Megazyme was strongly inhibited by glucose and maltose At a concentration...

Ngày tải lên: 22/02/2014, 07:20

11 611 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... semiconserved in yellow but it is fair to say that the < /b> similarity with the < /b> fusion domain of < /b> a virus is strongly suggestive of < /b> membrane disruption The < /b> recent observation of < /b> a strong synergism between Ab and ... activity The < /b> choice of < /b> the < /b> solvent is crucial not only to overcome the < /b> solubility problem, but also to try to simulate in some aspects the < /b> physico-chemical Fig Stereo view of < /b> the < /b> lowest energy ... in the < /b> mixture The < /b> ellipticity increases with the < /b> water concentration, reaching a plateau at approximately 20% water Correspondingly, the < /b> helix content, as estimated by standard linear combination...

Ngày tải lên: 08/03/2014, 09:20

7 624 0
Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

... (5¢-GCTTCGGCGGCCTGCTCTCC-3¢) and N373Drev (5¢-AGCCGATCAGCGGATCGATTTTGTG CCGG-3¢) were used For the < /b> PCR fragment encoding the < /b> corresponding C-terminal part, primers Bstrev10800 (5¢-GGCAAACCAGTGGGTGATTTTTCG-3¢) ... decarboxylase activity on pH The < /b> different mutants are indicated in the < /b> box on the < /b> top right The < /b> scale for the < /b> velocity of < /b> the < /b> mutants is indicated on the < /b> left side and that for the < /b> wild-type enzyme ... indicating that by this mutation OadB adopts a conformation that is more susceptible to proteolysis than the < /b> wildtype To investigate whether the < /b> Na+ translocating activity was retained in the < /b> S382A...

Ngày tải lên: 08/03/2014, 23:20

8 509 0
Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

... 5¢-CTGCCTCCAGCTTGAATACAG AAATG-3¢; N424D, sense 5¢-AGATTTGGGGATAC TTCATCTAGCTCAATTT-3¢, antisense 5¢-AGATGAAGT ATCCCCAAATCTATGTAACG-3¢; N424H, sense 5¢-AGATTTGGGCATACTTCATCTAGCTCA-3¢, antisense ... inactive enzyme Taken together, the < /b> analysis of < /b> the < /b> decarboxylation activity and characterization of < /b> the < /b> mutants of < /b> the < /b> putative catalytic triad strongly support the < /b> hypothesis that the < /b> membrane-bound ... (CAT)6ACTTCCGTTAACGTTAAGCTCCTTTAC-3¢ and the < /b> antisense primer 5¢-CGCGGATCCGCGTTAG Ó FEBS 2002 Mechanistic studies of < /b> FAE1 KCS (Eur J Biochem 269) 3533 GACCGACCGTTTTGGACATGAGTCTT-3¢ were used To facilitate...

Ngày tải lên: 24/03/2014, 03:21

9 457 0
Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

... noncompetitively by binding to the < /b> CnB-binding helix, CnB, and one side of < /b> the < /b> substrate-binding cleft of < /b> the < /b> catalytic site to alter the < /b> active-site geometry [16,17,20,22] As the < /b> mechanism of < /b> inhibition ... complexes affect the < /b> substrate-binding cleft Thus, both the < /b> catalytic subunit and substrate may influence the < /b> degree of < /b> inhibition of < /b> CaN phosphatase activity by FKBP12/FK506 and CyPA/CsA The < /b> differences ... conformational changes in CnB to the < /b> active site [22] In fact, the < /b> catalytic activity of < /b> CaN is sensitive to the < /b> amino-acid composition of < /b> the < /b> region linking the < /b> CnB-binding helix to the < /b> b1 4 strand...

Ngày tải lên: 24/03/2014, 03:21

9 473 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

... discourse its unity may be impossible to give without considering the < /b> world at large: the < /b> context. Context of < /b> culture Context of < /b> situation TEXT Figure 1.1: Theory of < /b> context of < /b> situation Cook, in the < /b> ... interpretation of < /b> the < /b> text which follows it The < /b> first sentence of < /b> the < /b> first paragraph will constrain the < /b> interpretation not only of < /b> the < /b> paragraph, but also of < /b> the < /b> rest of < /b> the < /b> text 1.2 Background information ... participants and relationships between them, background knowledge and assumptions underlying the < /b> event Figure 1.2: Types of < /b> context The < /b> first of < /b> these is the < /b> linguistic context - the < /b> language that surrounds...

Ngày tải lên: 18/12/2013, 10:08

44 579 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... affects both the < /b> binding affinity and specificity (Table 2) clearly A suggest that the < /b> CPY-binding sites [8] and the < /b> phospholipid recognition site of < /b> IC overlap, and that the < /b> N-terminal segment at the < /b> ... during the < /b> stationary phase, and is subsequently sorted into the < /b> lumens to regulate the < /b> vacuolar CPY activities through complex formation with the < /b> cognate protease The < /b> interaction of < /b> IC with the < /b> yeast ... 24 1.7 the < /b> positively charged residues of < /b> IC initially attract the < /b> inhibitor to the < /b> membrane surface, and that the < /b> membrane–protein interactions are then further stabilized by short-range specific...

Ngày tải lên: 19/02/2014, 05:20

10 646 1
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... on the < /b> total protein affinity to oxygen and on the < /b> subunit affinity were studied [17] The < /b> results indicate that the < /b> allosteric effectors modulate the < /b> O2 rebinding to the < /b> a and b subunits in two ... rebinding with dimer to the < /b> total protein oxygenation must be taken into account and the < /b> effect of < /b> NaCl concentration on the < /b> rates of < /b> O2 binding to the < /b> a and b subunits within the < /b> dimer must be found ... oxygenation is assumed to be altered with increasing ionic strength of < /b> the < /b> solvent [31] Therefore, to investigate the < /b> effect of < /b> NaCl on O2 binding to tetrameric HbA, the < /b> contribution of < /b> O2 rebinding...

Ngày tải lên: 16/03/2014, 14:20

11 577 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt

... component High glucose content was due to the < /b> presence of < /b> glucans in the < /b> LPS preparation GC of < /b> acetylated or trimethylsilylated (R)-2-butyl glycosides was used to determine the < /b> absolute configuration ... lactam formation MS ⁄ MS experiments led to the < /b> observation of < /b> a signal at m ⁄ z 199.2, corresponding to a cyclic AA component The < /b> cyclic structure of < /b> the < /b> AA was confirmed by the < /b> observation of < /b> the < /b> ... C-5: H-2 HMBC correlation There was no data for the < /b> determination of < /b> the < /b> configuration of < /b> chiral atoms Taken together, these experimental data agreed with the < /b> structure (Fig 4) As only one Qui4N...

Ngày tải lên: 30/03/2014, 10:20

12 397 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... rat X mouse cell hybrids that segregate rat chromosomes [10] The < /b> hybrids were typed by PCR with the < /b> following primers: 5¢-GGAGCAGCTGGAGT CATG-3¢ and 5¢-GGTCATCCTGTATCCTTCA-3¢ (the < /b> 5¢ end of < /b> these ... of < /b> primary antibody by the < /b> anti -B reagent, suggesting that the < /b> new rat gene encodes an enzyme with the < /b> catalytic activity of < /b> the < /b> A histoblood group transferase To confirm this result, the < /b> enzyme ... cannot be synthesized by the < /b> enzyme product of < /b> an allele at the < /b> Abo locus It is to be expected that another gene encodes a galactosyltransferase with B histo-blood group activity The < /b> enzyme activity...

Ngày tải lên: 31/03/2014, 09:20

8 499 0
Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

... u = + x/ b and obtain I = = e b bb+1 b! √ b be b b b! B x x dx √ b log + √ − √ b b b B x x x e x /2 + √ + − + + O (b 3/2 ) dx 18 −∞ b b √ exp − b (3.2) Evaluating explicitly the < /b> integrals in (3.2) ... of < /b> binary symbols We assume that every symbol is equally likely, thus the < /b> strings are emitted by an unbiased memoryless source Our interest lies in establishing the < /b> asymptotic distribution of < /b> the < /b> ... Here the < /b> loop integral is around any closed loop about the < /b> origin To gain more insight into the < /b> structure of < /b> this probability distribution, it is useful to evaluate (2.5) in the < /b> asymptotic limit...

Ngày tải lên: 07/08/2014, 06:20

16 352 0
Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

... with the < /b> advent of < /b> the < /b> N activity, indicates a relationship ase between both enzyme activities The < /b> low NR activity (!1 nmol N0 DW!h-!) of < /b> -mg2 nodulated plants could be greatly increased by nitrate ... expanded, the < /b> NR activity decreased in the < /b> previous leaf and the < /b> highest enzyme activity was found again in the < /b> new leaf (Fig 2) When the < /b> nitrate supply was withdrawn, the < /b> enzyme activity recovered its ... nitrate supplied via the < /b> roots This inducible NR activity was consistently ) DW-h- was highest in the < /b> younger expanded leaves that showed the < /b> highest nitrate content Studies are in progress to...

Ngày tải lên: 09/08/2014, 04:20

4 202 0
Báo cáo y học: " Retroviral activation of the mir-106a microRNA cistron in T lymphoma" potx

Báo cáo y học: " Retroviral activation of the mir-106a microRNA cistron in T lymphoma" potx

... chr13:52820992 G- T+ G+ T+ G- TG+TG-TT+GT+GG+TG -T+ G+ TG+TT+GG +T+ G- T+ G+ T+ T+ GG +T+ G+ TG+TG -T+ G- TG+TG +T+ G- T+ G+ TG -T+ T -G- Growth factor independent Jouberin Two pore segment channel Plasmacytoma variant translocation ... chrX:49002308 chrX:49004115 chrX:49005225 G- TG -T+ G- T+ G- TG -T+ G- TG -T+ G- T+ G- TG -T+ G- TG-TG -T+ G- TG -T+ G- T+ G- T+ G- T+ G- T+ G- T+ G- T- Retroviral insertion site locations (February 2006 version of < /b> ... reverse transcribed with the < /b> SuperScript First-Strand Synthesis System for RTPCR using the < /b> following stem loop RT primers (50 nM final concentration) 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACCTG-3'(mmumir-106a)...

Ngày tải lên: 13/08/2014, 09:20

7 317 0
Báo cáo y học: " Open Access Quantification of the virus-host interaction in human T lymphotropic virus I infection" pdf

Báo cáo y học: " Open Access Quantification of the virus-host interaction in human T lymphotropic virus I infection" pdf

... Using the < /b> resulting distribution, the < /b> probability of < /b> observing the < /b> test statistic under the < /b> null hypothesis was estimated and doubled to obtain a two-tailed P value The < /b> grouping of < /b> subjects produced ... produced by the < /b> algorithm was Bin TAQ, HT, HY, HBD; Bin TAY, HSa; Bin TBA, HBF; Bin TAT, HBH; Bin TAU, HSb; Bin TW, TAC, TBI, TBG, HAY Definition: high/ low rate of < /b> Tax expression The < /b> sample group ... rate of < /b> Tax expression in each of < /b> the < /b> bins was calculated and plotted against the < /b> mean CTL lysis rate in that bin (Fig 4B) The < /b> grouping of < /b> subjects produced by the < /b> algorithm was Bin TBG, TBI,...

Ngày tải lên: 13/08/2014, 09:21

9 383 0
The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

... antigen entry, the < /b> physical form < /b> of < /b> immunogen, the < /b> type of < /b> adjuvant, and the < /b> dose of < /b> antigen have been suggested The < /b> genetic mechanisms that control the < /b> type of < /b> T helper cell differentiation still ... depending on the < /b> disease setting and the < /b> site of < /b> regulatory activity Of < /b> note, aTreg functions in vivo in a cytokine-dependent manner So, it is proposed that aTreg is distinguished from nTreg not by their ... on DCs The < /b> main objective of < /b> this study is to address the < /b> question from the < /b> B cell perspective The < /b> first part of < /b> the < /b> study focused on the < /b> investigation of < /b> the < /b> immunomodulatory effects of < /b> LPS...

Ngày tải lên: 14/09/2015, 08:27

250 384 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... mutations, two oligonucleotide primers (sense, 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the < /b> major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ ... associa- Int J Med Sci 2007, tion between the < /b> genotype and the < /b> BMI among the < /b> Table Genotype distribution in NT subjects and EH patients Table The < /b> association between genotype and phenotype Table Plasma ... assessed by analysis of < /b> variance (ANOVA) The < /b> distributions of < /b> 148 the < /b> genotypes or alleles between EH patients and NT subjects were tested using a two-sided Fisher’s exact test Multiple logistic regression...

Ngày tải lên: 26/10/2012, 10:04

7 612 1
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

... hepatocytes This binding could be inhibited by recombinant HBs but not by the < /b> recombinant LHBs The < /b> binding of < /b> SHBs with human hepatocytes was further supported by the < /b> observation from Bruin et ... of < /b> SPIK gene expression supports our hypothesis that the < /b> suppression of < /b> the < /b> over-expression of < /b> SPIK gene might reinstate the < /b> susceptibility of < /b> HepG2 cell to HBV infection by the < /b> restoration of < /b> ... a target, further confirmed the < /b> role of < /b> LHBs in the < /b> HBV attachment [23] Recently, the < /b> attachment site of < /b> LHBs was functionally narrowed down to the < /b> amino acids 21–47 of < /b> preS1 by employing synthetic...

Ngày tải lên: 03/11/2012, 10:09

13 654 1
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

... Chapter Problem 2-19 The < /b> riveted bracket supports two forces Determine the < /b> angle θ so that the < /b> resultant force is directed along the < /b> negative x axis What is the < /b> magnitude of < /b> this resultant force? ... deg − θ + θ ) ⎟ α = 10.9 deg Problem 2-21 Determine the < /b> angle θ for connecting member B to the < /b> plate so that the < /b> resultant of < /b> FA and FB is directed along the < /b> positive x axis What is the < /b> magnitude ... that they create a resultant force having magnitude F R If two of < /b> the < /b> cables are subjected to known forces, as shown in the < /b> figure, determine the < /b> direction θ of < /b> the < /b> third cable so that the < /b> magnitude...

Ngày tải lên: 17/02/2014, 14:20

1,1K 1,1K 2
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

... particularly in the < /b> news in recent months due to aggressive state immigration laws It is interesting to note that Alabama ranks toward the < /b> bottom of < /b> the < /b> list of < /b> immigrant share of < /b> population (3 percent) ... owners the < /b> highest share of < /b> any group Immigrants born in Israel/Palestine (the < /b> Census does not disaggregate the < /b> two) are the < /b> group with the < /b> secondhighest rate of < /b> business ownership, followed by Syria, ... considerably by country of < /b> birth For immigrants from India, the < /b> share of < /b> small business owners among recent immigrants is percent but among better-established immigrants it is percent For immigrants...

Ngày tải lên: 18/02/2014, 00:20

37 436 0
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

... alter protein conformation There is good evidence from studies of < /b> the < /b> interaction of < /b> GS and its analogs with bacterial cells that the < /b> destruction of < /b> the < /b> integrity of < /b> the < /b> lipid bilayer of < /b> the < /b> inner ... previous suggestion that the < /b> low effective antimicrobial activity of < /b> GS14, particularly against Gram-negative bacteria, is due to its strong binding to the < /b> lipopolysaccharide component of < /b> the < /b> bacterial ... GS14 is then able to exert its intrinsically high antimicrobial activity However, the < /b> aggregation of < /b> GS14 in solution may also reduce its ability to penetrate the < /b> cell wall of < /b> Gram-negative bacteria,...

Ngày tải lên: 21/02/2014, 01:21

10 683 0
w