equations of the form y b g x t y •••••••••••••••

Tài liệu Báo cáo Y học: Puriﬁcation, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Ngày tải lên : 22/02/2014, 07:20

... dinitrosalicylic acid method Inhibition of the enzyme activity by glucose, maltose and cyclohexaamylose For the study of the enzyme inhibition by glucose, maltose and cyclohexaamylose b- amylase ... all other plant b- amylases including the C sepium b- amylase Studies of the crystal structure of recombinant soybean b- amylase complexed to b- cyclodextrin demonstrated the role of Glu186 and Glu380 ... at pH values below and above 12 irreversibly inactivated the protein Hydrolysis of the Betamyl b- amylase test reagent from Megazyme was strongly inhibited by glucose and maltose At a concentration...

11
611
0

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20

... semiconserved in yellow but it is fair to say that the similarity with the fusion domain of a virus is strongly suggestive of membrane disruption The recent observation of a strong synergism between Ab and ... activity The choice of the solvent is crucial not only to overcome the solubility problem, but also to try to simulate in some aspects the physico-chemical Fig Stereo view of the lowest energy ... in the mixture The ellipticity increases with the water concentration, reaching a plateau at approximately 20% water Correspondingly, the helix content, as estimated by standard linear combination...

7
624
0

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Ngày tải lên : 08/03/2014, 23:20

... (5¢-GCTTCGGCGGCCTGCTCTCC-3¢) and N373Drev (5¢-AGCCGATCAGCGGATCGATTTTGTG CCGG-3¢) were used For the PCR fragment encoding the corresponding C-terminal part, primers Bstrev10800 (5¢-GGCAAACCAGTGGGTGATTTTTCG-3¢) ... decarboxylase activity on pH The diﬀerent mutants are indicated in the box on the top right The scale for the velocity of the mutants is indicated on the left side and that for the wild-type enzyme ... indicating that by this mutation OadB adopts a conformation that is more susceptible to proteolysis than the wildtype To investigate whether the Na+ translocating activity was retained in the S382A...

8
508
0

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

Ngày tải lên : 24/03/2014, 03:21

... 5¢-CTGCCTCCAGCTTGAATACAG AAATG-3¢; N424D, sense 5¢-AGATTTGGGGATAC TTCATCTAGCTCAATTT-3¢, antisense 5¢-AGATGAAGT ATCCCCAAATCTATGTAACG-3¢; N424H, sense 5¢-AGATTTGGGCATACTTCATCTAGCTCA-3¢, antisense ... inactive enzyme Taken together, the analysis of the decarboxylation activity and characterization of the mutants of the putative catalytic triad strongly support the hypothesis that the membrane-bound ... (CAT)6ACTTCCGTTAACGTTAAGCTCCTTTAC-3¢ and the antisense primer 5¢-CGCGGATCCGCGTTAG Ó FEBS 2002 Mechanistic studies of FAE1 KCS (Eur J Biochem 269) 3533 GACCGACCGTTTTGGACATGAGTCTT-3¢ were used To facilitate...

9
457
0

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Ngày tải lên : 24/03/2014, 03:21

... noncompetitively by binding to the CnB-binding helix, CnB, and one side of the substrate-binding cleft of the catalytic site to alter the active-site geometry [16,17,20,22] As the mechanism of inhibition ... complexes affect the substrate-binding cleft Thus, both the catalytic subunit and substrate may inﬂuence the degree of inhibition of CaN phosphatase activity by FKBP12/FK506 and CyPA/CsA The differences ... conformational changes in CnB to the active site [22] In fact, the catalytic activity of CaN is sensitive to the amino-acid composition of the region linking the CnB-binding helix to the b1 4 strand...

9
473
0

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

Ngày tải lên : 18/12/2013, 10:08

... discourse its unity may be impossible to give without considering the world at large: the context. Context of culture Context of situation TEXT Figure 1.1: Theory of context of situation Cook, in the ... interpretation of the text which follows it The first sentence of the first paragraph will constrain the interpretation not only of the paragraph, but also of the rest of the text 1.2 Background information ... participants and relationships between them, background knowledge and assumptions underlying the event Figure 1.2: Types of context The first of these is the linguistic context - the language that surrounds...

44
578
0

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Ngày tải lên : 19/02/2014, 05:20

... affects both the binding affinity and specificity (Table 2) clearly A suggest that the CPY-binding sites [8] and the phospholipid recognition site of IC overlap, and that the N-terminal segment at the ... during the stationary phase, and is subsequently sorted into the lumens to regulate the vacuolar CPY activities through complex formation with the cognate protease The interaction of IC with the yeast ... 24 1.7 the positively charged residues of IC initially attract the inhibitor to the membrane surface, and that the membrane–protein interactions are then further stabilized by short-range specific...

10
645
1

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

Ngày tải lên : 16/03/2014, 14:20

... on the total protein afﬁnity to oxygen and on the subunit afﬁnity were studied [17] The results indicate that the allosteric effectors modulate the O2 rebinding to the a and b subunits in two ... rebinding with dimer to the total protein oxygenation must be taken into account and the effect of NaCl concentration on the rates of O2 binding to the a and b subunits within the dimer must be found ... oxygenation is assumed to be altered with increasing ionic strength of the solvent [31] Therefore, to investigate the effect of NaCl on O2 binding to tetrameric HbA, the contribution of O2 rebinding...

11
577
0

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the ﬁsh pathogen Francisella victoria ppt

Ngày tải lên : 30/03/2014, 10:20

... component High glucose content was due to the presence of glucans in the LPS preparation GC of acetylated or trimethylsilylated (R)-2-butyl glycosides was used to determine the absolute configuration ... lactam formation MS ⁄ MS experiments led to the observation of a signal at m ⁄ z 199.2, corresponding to a cyclic AA component The cyclic structure of the AA was confirmed by the observation of the ... C-5: H-2 HMBC correlation There was no data for the determination of the configuration of chiral atoms Taken together, these experimental data agreed with the structure (Fig 4) As only one Qui4N...

12
397
0

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Ngày tải lên : 31/03/2014, 09:20

... rat X mouse cell hybrids that segregate rat chromosomes [10] The hybrids were typed by PCR with the following primers: 5¢-GGAGCAGCTGGAGT CATG-3¢ and 5¢-GGTCATCCTGTATCCTTCA-3¢ (the 5¢ end of these ... of primary antibody by the anti -B reagent, suggesting that the new rat gene encodes an enzyme with the catalytic activity of the A histoblood group transferase To conﬁrm this result, the enzyme ... cannot be synthesized by the enzyme product of an allele at the Abo locus It is to be expected that another gene encodes a galactosyltransferase with B histo-blood group activity The enzyme activity...

8
499
0

Báo cáo toán học: "A Note on the Asymptotic Behavior of the Heights in b-Tries for b Large" ppt

Ngày tải lên : 07/08/2014, 06:20

... u = + x/ b and obtain I = = e b bb+1 b! √ b be b b b! B x x dx √ b log + √ − √ b b b B x x x e x /2 + √ + − + + O (b 3/2 ) dx 18 −∞ b b √ exp − b (3.2) Evaluating explicitly the integrals in (3.2) ... of binary symbols We assume that every symbol is equally likely, thus the strings are emitted by an unbiased memoryless source Our interest lies in establishing the asymptotic distribution of the ... Here the loop integral is around any closed loop about the origin To gain more insight into the structure of this probability distribution, it is useful to evaluate (2.5) in the asymptotic limit...

16
351
0

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Ngày tải lên : 09/08/2014, 04:20

... with the advent of the N activity, indicates a relationship ase between both enzyme activities The low NR activity (!1 nmol N0 DW!h-!) of -mg2 nodulated plants could be greatly increased by nitrate ... expanded, the NR activity decreased in the previous leaf and the highest enzyme activity was found again in the new leaf (Fig 2) When the nitrate supply was withdrawn, the enzyme activity recovered its ... nitrate supplied via the roots This inducible NR activity was consistently ) DW-h- was highest in the younger expanded leaves that showed the highest nitrate content Studies are in progress to...

4
202
0

Báo cáo y học: " Retroviral activation of the mir-106a microRNA cistron in T lymphoma" potx

Ngày tải lên : 13/08/2014, 09:20

... chr13:52820992 G- T+ G+ T+ G- TG+TG-TT+GT+GG+TG -T+ G+ TG+TT+GG +T+ G- T+ G+ T+ T+ GG +T+ G+ TG+TG -T+ G- TG+TG +T+ G- T+ G+ TG -T+ T -G- Growth factor independent Jouberin Two pore segment channel Plasmacytoma variant translocation ... chrX:49002308 chrX:49004115 chrX:49005225 G- TG -T+ G- T+ G- TG -T+ G- TG -T+ G- T+ G- TG -T+ G- TG-TG -T+ G- TG -T+ G- T+ G- T+ G- T+ G- T+ G- T+ G- T- Retroviral insertion site locations (February 2006 version of ... reverse transcribed with the SuperScript First-Strand Synthesis System for RTPCR using the following stem loop RT primers (50 nM final concentration) 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACCTG-3'(mmumir-106a)...

7
317
0

Báo cáo y học: " Open Access Quantification of the virus-host interaction in human T lymphotropic virus I infection" pdf

Ngày tải lên : 13/08/2014, 09:21

... Using the resulting distribution, the probability of observing the test statistic under the null hypothesis was estimated and doubled to obtain a two-tailed P value The grouping of subjects produced ... produced by the algorithm was Bin TAQ, HT, HY, HBD; Bin TAY, HSa; Bin TBA, HBF; Bin TAT, HBH; Bin TAU, HSb; Bin TW, TAC, TBI, TBG, HAY Definition: high/ low rate of Tax expression The sample group ... rate of Tax expression in each of the bins was calculated and plotted against the mean CTL lysis rate in that bin (Fig 4B) The grouping of subjects produced by the algorithm was Bin TBG, TBI,...

9
382
0

The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

Ngày tải lên : 14/09/2015, 08:27

... antigen entry, the physical form of immunogen, the type of adjuvant, and the dose of antigen have been suggested The genetic mechanisms that control the type of T helper cell differentiation still ... depending on the disease setting and the site of regulatory activity Of note, aTreg functions in vivo in a cytokine-dependent manner So, it is proposed that aTreg is distinguished from nTreg not by their ... on DCs The main objective of this study is to address the question from the B cell perspective The first part of the study focused on the investigation of the immunomodulatory effects of LPS...

250
384
0

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Ngày tải lên : 26/10/2012, 10:04

... mutations, two oligonucleotide primers (sense, 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ ... associa- Int J Med Sci 2007, tion between the genotype and the BMI among the Table Genotype distribution in NT subjects and EH patients Table The association between genotype and phenotype Table Plasma ... assessed by analysis of variance (ANOVA) The distributions of 148 the genotypes or alleles between EH patients and NT subjects were tested using a two-sided Fisher’s exact test Multiple logistic regression...

7
612
1

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Ngày tải lên : 03/11/2012, 10:09

... hepatocytes This binding could be inhibited by recombinant HBs but not by the recombinant LHBs The binding of SHBs with human hepatocytes was further supported by the observation from Bruin et ... of SPIK gene expression supports our hypothesis that the suppression of the over-expression of SPIK gene might reinstate the susceptibility of HepG2 cell to HBV infection by the restoration of ... a target, further confirmed the role of LHBs in the HBV attachment [23] Recently, the attachment site of LHBs was functionally narrowed down to the amino acids 21–47 of preS1 by employing synthetic...

13
654
1

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Ngày tải lên : 17/02/2014, 14:20

... Chapter Problem 2-19 The riveted bracket supports two forces Determine the angle θ so that the resultant force is directed along the negative x axis What is the magnitude of this resultant force? ... deg − θ + θ ) ⎟ α = 10.9 deg Problem 2-21 Determine the angle θ for connecting member B to the plate so that the resultant of FA and FB is directed along the positive x axis What is the magnitude ... that they create a resultant force having magnitude F R If two of the cables are subjected to known forces, as shown in the figure, determine the direction θ of the third cable so that the magnitude...

1.1K
1.1K
2

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Ngày tải lên : 18/02/2014, 00:20

... particularly in the news in recent months due to aggressive state immigration laws It is interesting to note that Alabama ranks toward the bottom of the list of immigrant share of population (3 percent) ... owners the highest share of any group Immigrants born in Israel/Palestine (the Census does not disaggregate the two) are the group with the secondhighest rate of business ownership, followed by Syria, ... considerably by country of birth For immigrants from India, the share of small business owners among recent immigrants is percent but among better-established immigrants it is percent For immigrants...

37
436
0

Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

Ngày tải lên : 21/02/2014, 01:21

... alter protein conformation There is good evidence from studies of the interaction of GS and its analogs with bacterial cells that the destruction of the integrity of the lipid bilayer of the inner ... previous suggestion that the low effective antimicrobial activity of GS14, particularly against Gram-negative bacteria, is due to its strong binding to the lipopolysaccharide component of the bacterial ... GS14 is then able to exert its intrinsically high antimicrobial activity However, the aggregation of GS14 in solution may also reduce its ability to penetrate the cell wall of Gram-negative bacteria,...

10
683
0