equations of the form f x y b a g x t y y •••••••••••

Báo cáo y học: "Participation of the PI-3K/Akt-NF-κB signaling pathways in hypoxia-induced mitogenic factor-stimulated Flk-1 " pot

Ngày tải lên : 12/08/2014, 16:20

... designed as follows: forward mutation 5'-TATCGATAGGTACCGGACGCACCGAGTCCCCACCCCT, forward deletion 5'-TATCGATAGGTACCGGACGCACCCCACCCCT, reverse 5'TGCGTC CGGTACCTATCGATAGAG AAATGTT The DNA constructs ... VEGF 5'-TGGAT GTCTACCAGCGAAGC-3' and 5'-ACAAGGCTCACAGTGATTTT-3' amplifying a 308-bp fragment between positions 522 and 829; for mouse GAPDH, 5'GCCAAGGTCATCCATGA CAACTTTGG-3' and 5'-GCCTGCTTCACCACCTTCTTGATGTC-3' ... 419 to 439 of fourth exon) amplifying a 336-bp fragment; for mouse Flk-1 5'-GCATCACCAGCAGCCAGAG-3' and 5'GGGCCATCCACTTCAAAGG-3' amplifying a 327-bp fragment between positions 3095 and 3421; for...

14
221
0

Báo cáo y học: "Understanding the roles of the transcription factors nuclear κ α factor-κB and hypoxia-inducible factor-1α in lung injury" pptx

Ngày tải lên : 12/08/2014, 19:21

... proinflammatory cytokines also activate HIF-1α stability and DNA binding This effect was most profound in hypoxic conditions and was, in fact, greater than that in hypoxaemia alone It is felt that ... inflammation and lung injury α Hypoxia-inducible factor-1α: role in hypoxaemia-initiated lung injury The master regulatory element of hypoxic conditions and adapting oxidative stresses to gene ... hypoxia and inflammatory lung injury These include erythropoietin, vascular endothelial growth factor (VEGF) and glucose transporter [9–11] Work by Haddad [12,13] has demonstrated that proinflammatory...

2
193
0

Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"

Ngày tải lên : 25/10/2012, 11:04

... and was 0.86 Fig Unilateral absence of the frontal sinus; on the right, the absence of the frontal sinus, and on the left, the limited aeration of the frontal sinus; axial view (A) , right sagittal ... investigations and for neurosurgeons performing pterional or supraorbital craniotomy because of the proximity of the sinus to the orbit and the anterior skull base [5] The frequency of bilateral absence of ... puberty, the minimum age of these cases was 15 years A weighted kappa test was performed to determine the reliability of this method Intra- and inter-observer agreement was analyzed using the...

5
577
0

Tài liệu Báo cáo Y học: Identiﬁcation and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Ngày tải lên : 22/02/2014, 07:20

... complementary deoxyoligonucleotide (5¢-CGCGGATCCATGTATAAGACAATCATTATGC-3¢) containing a BamHI site (underlined nucleotides) and a 3¢ deoxyoligonucleotide harboring a HindIII site (5¢-CCCAA GCTTTTAACGCACAACCAGCACC-3¢) ... the beginning of growth (Fig 4A) For comparison, the amount of GroEL was determined in the same extracts using anti-GroEL Ig It has been previously shown that at the beginning of the stationary ... mutant does not express UP12 (Fig 6A ,B, insets) The ability of the mutant strain to resume growth after the stationary phase was then compared Fig Eﬀect of toxic agents and temperature shift on...

9
548
0

Báo cáo Y học: Identiﬁcation of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx

Ngày tải lên : 08/03/2014, 23:20

... GGATTAACTTTTAACAGTGGTGGCTAC 3¢ 5¢ GGCTACAACCTCNNNGTCGGAGCTCGT 3¢ Zn-binding E334 E354 E429 5¢ CAATACTGATGCTNNNGGTAGGCTCACA 3¢ R431 5¢ CAATACTGATGCTGACGGTAGGCTCACA 3¢ 5¢ CAATACTGATGCTAGCGGTAGGCTCACA ... but significant activity on each substrate (Table 3) The D347R enzyme retained the ability to hydrolyze eight of the nine Leu-Xaa substrates at significantly higher rates than other D347 mutants ... identification of bicarbonate in the active site of the native E coli PepA and blLAP and the influence of bicarbonate on PepA hydrolysis of a chromogenic substrate [24] suggests that bicarbonate may act...

11
423
0

Báo cáo khoa học: Spectroscopic characterization of the isolated heme-bound PAS-B domain of neuronal PAS domain protein 2 associated with circadian rhythms doc

Ngày tải lên : 16/03/2014, 22:20

... His302Ala mutant, 5¢-GGTTGCAAACCGCCTACTA CATCACCTAC-3¢ and 5¢-GTAGGTGATGTAGTAGGC GGTTTGCAACC-3¢ for the His329Ala mutant, and 5¢CTACATCACCTACGCCCAATGGAACTCC-3¢ and 5¢GGAGTTCCATTGGGCGTAGGTGATGTAG-3¢ ... as follows: 5¢-ATTTCTGGATGCCAGAGCTCCTCCAATC-3¢ and 5¢-GATTGGAGGAGCTCTGGCATCCAGAAAT-3¢ for the His266Ala mutant, 5¢-GGCTACGACTACTACGC CATTGATGACC-3¢ and 5¢-GGTCATCAATGGCGTAG TAGTCGTAGCC-3¢ for the ... His289Ala mutant, 5¢-CTGG CCAGGTGCGCCCAGCATCTGATG-3¢ and 5¢-CATCA GATGCTGGGCGCACCTGGCCAG-3¢ for the His300Ala mutant, 5¢-GTGCCACCAGGCTCTGATGCAGTTTGG-3¢ and 5¢-CCAAACTGCATCAGAGCCTGGTGGCAC-3¢ for the...

10
360
0

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt

Ngày tải lên : 23/03/2014, 21:20

... As indicated above, the effects of such treatments are blocked by inhibitors of these pathways In contrast, Mnk 2a has high basal activity, which is not enhanced further by agents that activate ... binding constant for the eIF4EÆeIF 4G interaction is about three orders of magnitude higher than for capbinding by eIF4E [54] indicating that the eIF 4F complex will likely stay intact (note that the ... ANALYSIS OF THE EFFECTS OF eIF4E PHOSPHORYLATION ON ITS PROPERTIES The effect of phosphorylation on the properties of eIF4E has been the subject of substantial interest Given that stimuli that...

10
504
0

báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

Ngày tải lên : 21/06/2014, 00:20

... as r ® not faster than any power of r.) Hence, the order of system (3) is strongly degenerate at the point x = because of a > Let S be a non-degenerate matrix such that S S−1 = J = diag Lm0 (λ0 ... the first boundary value problem for a system of elliptic equations that strongly degenerate at a point Boundary Value Problems 2011 2011:16 Submit your manuscript to a journal and bene t from: ... systems degenerating at an inner point Math Model Anal 6(1), 147–155 (2001) Rutkauskas, S: On the Dirichlet problem for a system of degenerate at a point elliptic equations in the class of bounded...

11
399
0

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Ngày tải lên : 09/08/2014, 04:20

... enzyme activity (Fig 2) After 72 h of induction, the highest NR activity was found in the apical fully expanded leaf and corresponded with the highest nitrate content (Table I) When a new leaf ... leaf expanded, the NR activity decreased in the previous leaf and the highest enzyme activity was found again in the new leaf (Fig 2) When the nitrate supply was withdrawn, the enzyme activity recovered ... decrease, concomitant with the advent of the N activity, indicates a relationship ase between both enzyme activities The low NR activity (!1 nmol N0 DW!h-!) of -mg2 nodulated plants could be greatly...

4
202
0

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Ngày tải lên : 09/08/2014, 08:22

... competing interests Authors' contributions SE, JW and AB contributed to the study design SE, CP and JB generated the data SE and AB undertook the analysis SE, JW and AB participated in the preparation ... included across the plates to ensure accuracy of genotyping In addition, for all the assays, genotyping was confirmed in a subset of samples using the Pyrosequencing genotyping method according to manufacturer's ... because they had all been associated with RA in the Japanese population on single-point analysis, because the SNPs formed a haplotype associated with RA and because the most probable disease causal...

5
406
0

Báo cáo y học: ":Evaluation of the Patient Acceptable Symptom State in a pooled analysis of two multicentre, randomised, double-blind, placebo-controlled studies evaluating lumiracoxib and celecoxib in patients with osteoarthritis" pptx

Ngày tải lên : 09/08/2014, 10:20

... achieved for a patient to be satisfied according to PASS Assessment of patient satisfaction by means of the PASS criteria can be approached in a number of ways: satisfaction at the end of a study period, ... al Figure Patient's global assessment of disease activity (a) Percentage of patients considering their state as satisfactory according to Patient Acceptable activity Symptom State (PASS) at weeks ... Sloan VS: Evaluation of the clinical relevance of the symptomatic efficacy of lumiracoxib in osteoarthritis utilising the Patient Acceptable Symptom State (PASS) concept [abstract P130] Osteoarthritis...

11
455
0

Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx

Ngày tải lên : 09/08/2014, 14:22

... conception of the study, and acquisition, analysis and interpretation of the data, and participated in drafting the manuscript RG participated in the analysis and interpretation of the data SG contributed ... different from that of a random population, and they may have a tendency to exaggerate self-perceived severity The repeatability of the FAS index was excellent, as shown by the CCC, and the Bland-Altman ... Assessment plot of repeatability, with the average values Bland and Altman Status values plotted against differences in Fibromyalgia Assessment Status values plotted against average values Ninetyfive...

12
423
0

Báo cáo y học: "A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report" pdf

Ngày tải lên : 10/08/2014, 10:20

... sustained contraction of the shoulder girdle, upper arm, and forearm muscles to hold the rug against the force of the weight of the rug and gravity Because of the superficial location of the ... only case stating that the anterior branch of the MACN was damaged was lipoma [10] Our case, however, is the only case describing isolated neuropathy of the anterior branch of the MACN which was ... neuropathy was stated to be soft tissue laceration but the shape and the cause of the injury was not described [6] Chang and Ho reported that MACN neuropathy described in one of their cases was not...

4
349
0

Báo cáo y học: "The clinical assessment study of the foot (CASF): study protocol for a prospective observational study of foot pain and foot osteoarthritis in the general population" docx

Ngày tải lên : 10/08/2014, 21:24

... the dorso-plantar view the participant will stand with the plantar aspect of both feet on the detector The x- ray tube will be angled 15° cranially with a vertical central ray centred at the base ... base of the third metatarsal [24] For lateral projections the participant will stand on a low platform with the detector positioned at the side of the participant’s foot The x- ray tube will be ... confirmed by letter Discretionary notification of other significant radiographic abnormality At the discretion of the Consultant Rheumatologist, the General Practice will be notified of other...

16
554
0

Báo cáo y học: "Congenital aplasia of the optic chiasm and esophageal atresia: a case report" pptx

Ngày tải lên : 10/08/2014, 23:22

... the parents of the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Abbreviations ... visual impairment, in contrast to most of the cases described in literature that maintain a good– or at least useful–visual function The lack of fixation and reactivity to light or structured stimuli ... with EA in our case would be hard to explain Sami et al [1] have suggested a classification system for patients affected by achiasmia: type A, presenting with isolated achiasmia and often nystagmus,...

5
415
0

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" potx

Ngày tải lên : 11/08/2014, 03:21

... signing out of the histopathology report, conducting the literature review and drafting the manuscript MH was the clinician-in-charge of the daily care of the patient, provided the clinical background, ... histopathologic examination remains the mainstay of an accurate diagnosis Page of Lewin M, Nazarian S, Marine JE, Yuh DD, Argani P, Halushka MK: Fatal outcome of a calcified amorphous tumor of the ... mobile left atrial masses (may also involve the right atrium) About 20% of the myxomas may be calcified [10] Cardiac fibromas may also be calcified; however, they are predominantly left ventricular...

3
316
0

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" docx

Ngày tải lên : 11/08/2014, 07:20

... signing out of the histopathology report, conducting the literature review and drafting the manuscript MH was the clinician-in-charge of the daily care of the patient, provided the clinical background, ... histopathologic examination remains the mainstay of an accurate diagnosis Page of Lewin M, Nazarian S, Marine JE, Yuh DD, Argani P, Halushka MK: Fatal outcome of a calcified amorphous tumor of the ... mobile left atrial masses (may also involve the right atrium) About 20% of the myxomas may be calcified [10] Cardiac fibromas may also be calcified; however, they are predominantly left ventricular...

3
533
0

Báo cáo y học: "Moderate size infantile haemangioma of the neck – conservative or surgical treatment? : a case report" pptx

Ngày tải lên : 11/08/2014, 11:20

... were they to become public after the publication of the manuscript Authors' contributions HA carried out the figures formatting, participated in the sequence alignment HM participated in the sequence ... was obtained from the patient's parents for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal ... authors declare that they have no competing interests The authors confirm that there are no financial competing interests and no non-financial competing interests that may cause embarrassment...

4
433
0

Báo cáo y học: "nvasive lobular carcinoma of the breast presenting as retroperitoneal fibrosis: a case report" ppsx

Ngày tải lên : 11/08/2014, 12:20

... diagnosis of idiopathic RPF and it was not until the final pathology was available that the diagnosis of malignancy was made Fibromatosis of the deep tissues often behaves more aggressively than ... infiltrating lobular carcinoma and infiltrating duct carcinoma of the breast Br J Cancer 1984, 50:23-30 Lamovec J, Bracko M: Metastatic pattern of infiltrating lobular carcinoma of the breast: an autopsy ... presented with RPF and ureteral obstruction Our case also draws the attention to the need for a thorough physical examination of the patients with RPF including breast and gynecological organs It also...

4
325
0

Báo cáo y học: " A cross-sectional testing of The Iowa Personality Disorder Screen in a psychiatric outpatient setting" pot

Ngày tải lên : 11/08/2014, 15:22

... loadings) and an adequate fit value Page of We found that the GSI and the GAF-S as measures of psychopathology and the GAF -F as a measure of function as well as the IPDS were significantly associated ... Norway Authors’ contributions IO participated in the design, collected data and drafted the manuscript of the study ØS performed statistical analyses and helped to draft the manuscript AAD participated ... usually self if the ways they have been in recent weeks or months are different from the way they usually are The IPDS was translated and back-translated into Norwegian by the last author with permission...

8
332
0