equations containing the unknown function of a complicated argument

... manipulate the factorization for theoretical results Theorem 10 makes it clear that the problem of factoring the generalized zeta function is really a problem of factoring the zeta function of ... given graphs are isomorphic We say two graphs are cospectral if the spectra of their adjacency matrices are the same For general graphs, the Ihara-Selberg zeta function can be useful as a tool ... instead 3.1 Consequences of the Factorization Our first observation is that the zeta function of a hypergraph is a non-trivial generalization of the Ihara-Selberg zeta function By this, we mean that...

Ngày tải lên: 07/08/2014, 13:21

... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein, ... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state ... 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the multicloning site This plasmid was designated as...

Ngày tải lên: 31/03/2014, 07:20

... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i ... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... Israilov, Numbers of solutions of linear Diophantine equations and their applications in the theory of invariant cubature formulas, Sibirsk Mat Zh 22 (1981), no 2, 121–136, 237 English translation:...

Ngày tải lên: 07/08/2014, 06:22

... have the same zeta function Proof The pair were shown to have the same zeta function by evaluating Bass’ formula (2) for each graph with Mathematica, and showing that the resulting functions are ... direct calculation in mathematica shows the two graphs have equal zeta functions In Case 2, again a direct check using mathematica confirms that the two graphs have equal zeta functions To find the ... regular, its spectrum can be computed from the zeta function The adjacency matrix A is always a real symmetric matrix, hence always diagonalizeable On the other hand, if G is regular then both Q and...

Ngày tải lên: 08/08/2014, 01:20

... zeta functions of graphs, and showed that the reciprocals of zeta functions of regular graphs are explicit polynomials A zeta function of a regular graph G associated with a unitary representation ... of the fundamental group of G was developed by Sunada [11,12] Hashimoto [4] treated multivariable zeta functions of bipartite graphs Bass [2] generalized Ihara’s result on the zeta function of ... formula, and discussed three different zeta functions of any graph Various proofs of Bass’ Theorem were given by Kotani and Sunada [7], and Foata and Zeilberger [3] Let G be a connected graph Then the...

Ngày tải lên: 08/08/2014, 01:20

... diagnosis of lung cancer, pneumonia, study withdrawal and death The 13 remaining patients (5 females and males) had an average age of 63 ± years (Tables 2) The anesthetic drugs used in the CABG group ... Statistical analysis was performed in Statistica version 7.0 (Stasoft Corporation, Tulsa, USA) Sample size was calculated and resulted in 10 patients, to achieve an alpha error of 0.05 and power of ... before and after CABG, its acute effects on cardiovascular function are not yet clear as the only data in this area are from healthy individuals [26] Herdy et al [7] investigated the hypothesis that...

Ngày tải lên: 10/08/2014, 09:21

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

Ngày tải lên: 24/12/2013, 01:17

... neurofibrillary changes associated with AD Potential role of metal-binding/exchange properties of GIF in AD One of the primary pathological hallmarks of AD is the formation of b-amyloid (Ab) plaques, composed ... some of the current thoughts on the role of GIF in AD There are numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant ... levels of GIF are altered dramatically in the neurodegenerative or traumatically injured brain The bestcharacterized example of this is for AD Indeed, many studies have analysed the amount of GIF present...

Ngày tải lên: 16/02/2014, 15:20

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... lgÆmL)1 ampicillin, sodium salt, 50 lM iron(III) sulfate and 50 lM manganese sulfate When the D600 of the culture reached a value of 0.4, IPTG was added to a final concentration of 10 mM and the culture...

Ngày tải lên: 21/02/2014, 01:21

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria...

Ngày tải lên: 07/03/2014, 00:20

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...

Ngày tải lên: 08/03/2014, 22:20

... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...

Ngày tải lên: 08/03/2014, 22:20

Ngày tải lên: 12/03/2014, 00:21

... variables and the estimate of the stable degree of the Renyi’s characteristic theorem, Acta Mathemaica Vietnamica 21 (1996) 269 [3] C G Essen, Fourier analysis of distribution functions, Acta ... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University ... References [1] Tran Kim Thanh, On the characterization of the distribution of the composed random variables and their stabilities Dotor thesis, Hanoi 2000 [2] Tran Kim Thanh, Nguyen Huu Bao, On the geometric...

Ngày tải lên: 14/03/2014, 13:20