elements single nucleotide polymorphisms and neurologic and psychiatric illness

... wild and cultivated sunflower Results SNPs frequency and nucleotide diversity A total of 64 candidate regions related to biotic and abiotic stresses were selected for SNP identification and nucleotide ... feb252001/524.pdf] Kwok PY: Methods for genotyping single nucleotide polymorphisms Annu Rev Genomics Hum Genet 2001, 2:235-258 Rafalski A: Applications of single nucleotide polymorphisms in crop genetics Curr ... A: Mining singlenucleotide polymorphisms from hexaploid wheat ESTs Genome 2003, 46(3):431-437 Van K, Hwang EY, Kim MY, Kim IH, Cho YI, Cregan PB, Lee SH: Discovery of single nucleotide polymorphisms...

Ngày tải lên: 12/08/2014, 05:20

... and GL provided study materials or patients HSB, PS, JG, AB, CW and GL participated in collection and assembly of data CP and AS participated in data analysis and interpretation CB, HSB, AB and ... doi:10.1186/1479-5876-9-139 Cite this article as: Bergmann et al.: Toll-like receptor singlenucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas Journal of Translational Medicine ... Informatics, Biometry and Epidemiology, University of Duisburg Essen, Hufelandstrasse 55, 45122 Essen, Germany Authors’ contributions CB designed the study and participated in data analysis and interpretation...

Ngày tải lên: 18/06/2014, 22:20

... and GL provided study materials or patients HSB, PS, JG, AB, CW and GL participated in collection and assembly of data CP and AS participated in data analysis and interpretation CB, HSB, AB and ... doi:10.1186/1479-5876-9-139 Cite this article as: Bergmann et al.: Toll-like receptor singlenucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas Journal of Translational Medicine ... Informatics, Biometry and Epidemiology, University of Duisburg Essen, Hufelandstrasse 55, 45122 Essen, Germany Authors’ contributions CB designed the study and participated in data analysis and interpretation...

Ngày tải lên: 20/06/2014, 04:20

... samples and participated in the design and analysis of the study, and MN genotyped the Japanese samples JD, JQ, NJ, YX, CY and JW evaluated the patients and genotyped Chinese samples, and TN helped ... Nanjing University, and single nucleotide Page of (page number not for citation purposes) polymorphism (SNP) Research Center of RIKEN, and informed consent was obtained from patients and control individuals ... association between the RHOB and TXNDC3 SNPs and knee OA susceptibility, we conducted two case-control studies in Han Chinese and Japanese populations and a meta-analysis Materials and methods A population...

Ngày tải lên: 09/08/2014, 10:23

... Incest and mental handicap J Ment Defic Res 1990, 34:483-490 doi:10.1186/gm163 Cite this article as: Beaudet AL: Ethical issues raised by common copy number variants and single nucleotide polymorphisms ... cost effective, is not evidence based and may lead to stigmatization or undue anxiety [15,16] Assuming lowcost and high-throughput genotyping and good physician and patient education, this form of ... disomy causing disorders such as Prader-Willi and Angelman syndromes and in identifying candidate gene regions for disease in children born of first cousin and similar matings However, the occurrence...

Ngày tải lên: 11/08/2014, 12:20

... analysis and statistical analyses; and wrote the manuscript HF, YK, SI, TH, MK, IM, ST, YT, HH and TS recruited the patients and controls and collected clinical information NT designed and coordinated ... panel consisting mainly of Chinese and Korean populations, the association of 27 singlenucleotide polymorphisms (SNPs) in the TLR7-TLR8 region with SLE was examined, and a significant association ... intron 2, rs179019 and rs179010, was newly detected (Figure and Table 1) Significant association of rs179019 and rs179010 was observed under the recessive model for the A and T alleles, respectively...

Ngày tải lên: 12/08/2014, 15:22

... Aspergillus Der p and/ or Der f 43 52 28 37 Cat 46 28 CR 28 22 Trees 78 57 Grasses 56 54 Weeds 68 48 The results of IL-4RA single nucleotide polymorphisms (SNP) are seen in Table The presence and allele ... chain; SNP single nucleotide polymorphisms Data presented as percentage (%) of patients and in parentheses, allele frequency P value using Fisher’s exact test Knutsen et al Clinical and Molecular ... PBMC were washed and stained with murine monoclonal antibody to CD23-PE and CD20 Per-CP (Becton Dickinson) PBMCs were washed and fixed with 1% PBS buffered paraformaldehyde Forward and sidescatter...

Ngày tải lên: 13/08/2014, 13:22

... Zoology 284, 217-224 Tao, W.J., Boulding, E.G., 2003 Associations between single nucleotide polymorphisms in candidate genes and growth rate in Arctic charr (Salvelinus alpinus L.) Heredity 91, 60-69 ... Identification and characterization of a hyperglycemic hormone from freshwater giant prawn, Macrobrachium rosenbergii Comparative Biochemistry and Physiology, Part A 121, 315-321 Liu, Z., 2007 Single nucleotide ... Physiological Zoology 70, 415-420 Schaid, D.J., Rowland, C.M., Tines, D.E Jacobson, R.M., Poland, G.A., 2002 Score tests for association between traits and haplotypes when linkage phase is ambiguous...

Ngày tải lên: 19/03/2014, 11:20

... products are denatured to become single- stranded, and separated by gel electrophoresis under nondenaturing conditions A single- stranded fragment with a mutation or single nucleotide polymorphism (SNP) ... Methods and Protocols, edited by Tanja Zigova, Juan R Sanchez-Ramos, and Paul R Sanberg, 2002 197 Mitochondrial DNA: Methods and Protocols, edited by William C Copeland, 2002 196 Oxidants and Antioxidants: ... Bing-Yuan Chen and Harry W Janes, 2002 191 Telomeres and Telomerase: Methods and Protocols, edited by John A Double and Michael J Thompson, 2002 190 High Throughput Screening: Methods and Protocols,...

Ngày tải lên: 08/04/2014, 12:52

... eht ni 631 nodoc ta msihpromylop editoelcun-elgniS PNRP reed akis eht fo pb 177 ;1 enal ,reddal AND pb 001 ;M )PNRP( eneg noirp reed akis eht fo noitacifilpmA giF giF la te gnoeJ gnoeJ-nuyH 003...

Ngày tải lên: 07/08/2014, 23:22

... years (17–81 years), and 76% were female A cohort of 171 healthy individuals matched on the basis of age, sex and origin were used as a healthy control group All protocols and recruitment sites ... performed by allele-specific PCR and verified by direct sequencing PCR primer and probe sequences for the V14M SNP were 5' -AGTGGAGTGGCTACAAAGGTCCC-3' (forward primer) and 5' CCCATCTCAGCCCTGCTCAC/T-3' ... (reverse primer) PCR primer and probe sequences for the L467P SNP were 5' CATGTGCTAGTGGATCTACT/C-3' (forward primer) and 5' AGTGGAGTGGCTACAAAGGTCCC-3' (reverse primer) Results and discussion In marked...

Ngày tải lên: 09/08/2014, 07:20

... pets, and livestock and are the source of the poison ricin [14] Castor bean plants commonly escape cultivation and are found in disturbed sites such as roadsides, stream banks, abandoned lots, and ... JTF, GJA, PDR, and PK analyzed the data and wrote the manuscript PK and PDR designed the study APC, PDR, and JR sequenced the cultivars, generated the methylation-filtration libraries and performed ... rates using single nucleotide polymorphisms Genetics 2000, 154:931-942 37 Wakeley J, Nielsen R, Liu-Cordero SN, Ardlie K: The discovery of singlenucleotide polymorphisms and inferences about human...

Ngày tải lên: 12/08/2014, 03:21

... Fallin D, Lanchbury JS: Single nucleotide polymorphisms and the future of genetic epidemiology Clin Genet 2000, 58:250–264 33 Gray IC, Campbell DA, Spurr NK: Single nucleotide polymorphisms as tools ... Lipshutz R, Chee M, Lander ES: Large-scale identification, mapping, and genotyping of single- nucleotide polymorphisms in the human genome Science 1998, 280:1077–1082 30 Kruglyak L, Lander E: High-resolution ... of single- nucleotide polymorphisms around APOE in Alzheimer disease Am J Hum Genet 2000, 67:383–394 39 Eberle MA, Kruglyak L: An analysis of strategies for discovery of single- nucleotide polymorphisms...

Ngày tải lên: 12/08/2014, 18:20

... Thơ, tháng 10 năm 2012 SNP (SINGLE NUCLEOTIDE POLYMORPHISMS) I GIỚI THIỆU VỀ SNP - SNPs (đọc snip) viết tắt từ chữ Single Nucleotide Polymorphisms, có nghĩa dạng đa hình nucleotide đơn Marker thường ... for Gold in Genome Gulch 2002 The Scientist 13 Single Nucleotide Polymorphisms: From the Evolutionary Past 2001 Nature 14 Single Nucleotide Polymorphisms: To a Future of Genetic Medicine ... biến điểm nucleotide genome (hình 1) Hình 1: Một đột biến điểm xảy dẫn đến thay cặp nucleotide G – C A – T ngược lại tạo SNP - Đa hình đơn nucleotide, SNPs biến thể trình tự DNA xảy đơn nucleotide...

Ngày tải lên: 18/03/2015, 09:12

... for Gold in Genome Gulch 2002 The Scientist 13 .Single Nucleotide Polymorphisms: From the Evolutionary Past 2001 Nature 14 .Single Nucleotide Polymorphisms: To a Future of Genetic Medicine ... AGT T T C A T C C C T A C GGT AAT T C AC AA GT AGGGAT Hình 2: Phân tích lai oligonucleotide tạo SNP Một oligonucleotide có tính chất bổ sung hoàn toàn alen bình thường, lai với DNA mục tiêu điều ... huỳnh quang đa màu Ried cộng sự; Balding & Ward giới thiệu Vào năm 1993, array chứa oligonucleotide ngắn, 19 nucleotide tổng hợp in situ Năm 1994, Hoheisel cộng tăng mật độ chấm (spot) cách dùng...

Ngày tải lên: 09/05/2016, 16:53

... GST polymorphisms and cancer outcome (mainly colorectal, breast, and lung malignancy) SNPs for GST polymorphisms were used as a substrate for analyses Materials and Methods Search strategy and ... studies is increasing rapidly and this trend is expected to accelerate due to the availability of mapped single- nucleotide polymorphisms (SNP) in the human genome and advances in genotyping technologies ... outcome (%) 1-3 polymorphisms tested 29 (74) 10 (26) > polymorphisms tested 17 (42.5) 23 (57.5) 1-3 polymorphisms tested 13 (48) 14 (52) > polymorphisms tested (7) 25 (93) 1-3 polymorphisms tested...

Ngày tải lên: 25/10/2012, 10:51

... 5-HTTLPR and rs25531 Isolation of DNA, genotyping of 5-HTTLPR and rs25531, as well as the classification of estimated phased haplotypes (SASA, SGSG, LGSA, and LGLG as S’S’; LA SA and LALG as L’S’; and ... Kucharska-Mazur J: Polymorphisms in the serotonin transporter and monoamine oxidase A genes and their relationship to personality traits measured by the Temperament and Character Inventory and NEO Five-Factor ... Minelli et al.: The influence of psychiatric screening in healthy populations selection: a new study and meta-analysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality...

Ngày tải lên: 11/08/2014, 15:22

... metrics In the single nucleotide polymorphism database (dbSNP) of the National Center for Biotechnology Information (NCBI), more than million polymorphisms including SNPs, small INDELs and microsatellite ... numbers [GenBank:EF589163–EF589342 and EU099042– EU099056] Authors' contributions SHK, HW, AMI and TJC designed the experiment SHK, PRB, and HW performed the research XC and JX accomplished the statistical ... single- feature polymorphisms using oligonucleotide arrays and robustified projection pursuit Bioinformatics 2005, 21:3852-3858 Walia H, Wilson C, Condamine P, Liu X, Ismail AM, Zeng LH, Wanamaker SI, Mandal...

Ngày tải lên: 12/08/2014, 03:20

... Online Mendelian Inheritance in Man; SNP, single nucleotide polymorphism Authors' contributions ZZ and JL designed the study JL and YZ collected the data and performed the data analysis XL participated ... between and Tablehere forbetweenS1-S3 variables Figurestudy, Figure S2 conAdditionalandfile correlation andgroups of proteins.theanafter SNP and file Acknowledgements We thank Kiran Mukhyala and ... accumulation of DNA variation data for human populations, including copy number variations and single nucleotide polymorphisms (SNPs) Currently, the dbSNP database [6] at the National Center of Biotechnology...

Ngày tải lên: 14/08/2014, 08:21

... of gene expression and screening for sequence variation While this has not yet been pursued to any extent so far, the ability of RNAseq to identify novel single nucleotide polymorphisms (SNPs) ... Greenbaum JA, Andrews RM, Flicek P, Boyle PJ, Cao H, Carter NP, Clelland GK, Davis S, Day N, Dhami P, Dillon SC, Dorschner MO, et al.: Identification and analysis of functional elements in 1% ... is dynamically and biologically Volume 9, Issue 9, Article 234 Cloonan and Grimmond 234.3 regulated on a genome-wide scale By surveying both rapidly proliferating mitotic cells and induced meiotic...

Ngày tải lên: 14/08/2014, 20:22