effects a big surprise

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function Pathol Int 50, 589–593 23 Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang ... [38] or anti-HA (Sigma) Gels were dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors ... AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin Nature 377, 649–652 29 Zlatanova J, Yaneva J & Leuba...

Ngày tải lên: 19/02/2014, 05:20

14 598 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

... uptake in HeLa cells by FACS analysis HeLa cells were incubated with increasing amounts of the rhodamine-labeled Tat peptide, as indicated in the ®gure Comparative FACS analysis of the internalization ... was proposed as the reason of this apparent increased uptake, as the rate of uptake was the same in serum-free medium [17] As already stated above, this Tat CPP peptide is able to vectorize various ... single-stranded bulge and loop of the trans- acting-responsive hairpin: a quantitative analysis J Virol 63, 5501±5504 Cordingley, M.G., LaFemina, R.L., Callahan, P.L., Condra, J.H., Sardana, V.V., Graham,...

Ngày tải lên: 21/02/2014, 03:20

8 485 0
Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc

Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc

... remains to be evaluated In mammalian cells, peroxisome proliferator-activated receptor alpha (PPARa) is critical for peroxisome induction [32] PPARa belongs to the superfamily of ligand-activated ... Erdmann 60 Hayashi Y, Hayashi M, Hayashi H, Hara-Nishimura I & Nishimura M (2001) Direct interaction between glyoxysomes and lipid bodies in cotyledons of the Arabidopsis thaliana ped1 mutant ... Dnm1p and Fzo1p antagonistically regulate mitochondrial shape J Cell Biol 147, 699–706 Mano S, Nakamori C, Kondo M, Hayashi M & Nishimura M (2004) An Arabidopsis dynamin-related protein, DRP 3A, ...

Ngày tải lên: 07/03/2014, 21:20

13 372 0
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot

Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot

... 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢ DNA concentrations are expressed as total nucleotide concentrations The oligonucleotide ... mM ATP (lane 6–10) and analysed by native PAGE (6% acrylamide) followed by silver staining Lane and has hRad51 (10 lM) without DNA and lane 11 had hRad52 (10 lM) with DNA The position of asterisk ... mM ADP (lanes 5–8), mM ATP (lanes 9–12), mM ATPcS (lanes 13–16) and analysed by native PAGE ( 6% acrylamide) followed by silver staining (B) Centrifugation assay hRad51 was incubated with varying...

Ngày tải lên: 16/03/2014, 14:20

9 378 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

... Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; Fah, ... indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the rat, ... Phosphoglycerate mutase Indolethylamine N-methyltransferase Peroxiredoxin Apolipoprotein A- I Abhydrolase domain containing 14b D-Amino Protein name ApoA4 ActB Nsfl1C Acy1 Pgam1 Inmt Prdx6 ApoA1 Abhd14b DnaJA1...

Ngày tải lên: 23/03/2014, 03:20

9 482 0
Báo cáo khoa học: Biogenesis of peroxisomes Topogenesis of the peroxisomal membrane and matrix proteins ppt

Báo cáo khoa học: Biogenesis of peroxisomes Topogenesis of the peroxisomal membrane and matrix proteins ppt

... Pharmacol 147, 75–121 Shibata H, Kashiwayama Y, Imanaka T & Kato H (2004) Domain architecture and activity of human Pex19p, a chaperone-like protein for intracellular trafficking of peroxisomal ... such as Pex3p and tailanchored peroxisomal membrane proteins (e.g Pex15p and APX) that are supposed to be targeted to a thus far uncharacterized circular reticular membrane compartment, namely ... and functional analysis Ann New York Acad Sci 804, 47–59 13 Dammai V & Subramani S (2001) The human peroxisomal targeting signal receptor, Pex5p, is translocated into the peroxisomal matrix and...

Ngày tải lên: 23/03/2014, 13:20

11 556 0
applications of chimeric genes and hybrid proteins, part a

applications of chimeric genes and hybrid proteins, part a

... immA imm21 immA, Kan R immA imm21 irnmA, Kan R IacZYA ' lacZYA ' lacZYA ' lac "ZYA' lac "ZYA' lac "ZYA' Transcriptional Transcriptional Transcriptional Translational Translational Translational ... ("CEKG 4") GTGCAGTAATATCGCCCTGAGCA GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT ATCCCCCTGGATGGAAAACGG GGCCACGCGTCGACTAGTAC "Three different ... necessary for translational initiation and contain functional copies of both lacZ and lacy genes, but are truncated in lacA (and are lacA ) Fusions designated lac'ZYA' are deleted for the translation...

Ngày tải lên: 10/04/2014, 11:02

614 282 0
applications of chimeric genes and hybrid proteins, part b

applications of chimeric genes and hybrid proteins, part b

... G TAT Y CTC L Eco47lll* GAG GAA E E Myc epitope CTC ATC TCA GAA LISEEDLNSAVDHHHHH GAT GAG CTG GCG A I Xbal’ CTC L TCT S CTA L AGC GCC GTC Apa I* ,GA? GGG E G CCC P GACrCAT CAT GAA E CAA Q AAA ... 5’-CCC AAG CTI GAG CAA AAG CTC ATT TCT GAA GAG GAC3’ and 5’-C CCG CTC GAG TTA AAG TIC GTC CTT CAA3’, so that the fragment produced is flanked by Hind111 and XhoI sites *G Odorizzi, A Pearse, D ... 60-91) are generated by PCR from cDNA provided by I Trowbridge (Salk Institute, San Diego, CA) The primers used are 5’-C TCG GAA TIC GGA TCC TCG AGA TGA AAA GGT GTA GTG GAA GTA3’ and 5’-C TAT GAA...

Ngày tải lên: 10/04/2014, 11:02

696 394 0
báo cáo hóa học:" Proteomic characterization of HIV-modulated membrane receptors, kinases and signaling proteins involved in novel angiogenic pathways" ppt

báo cáo hóa học:" Proteomic characterization of HIV-modulated membrane receptors, kinases and signaling proteins involved in novel angiogenic pathways" ppt

... pulmonary vascular endothelial cells J Biol Chem 2002, 277:5441-5447 138 Tazaki T, Miyazaki K, Hiyama E, Nakamoto T, Sakai R, Yamasaki N, Honda Z, Noda M, Miyasaka N, Sueda T, Honda H: Functional analysis ... cranial and vertebral defects Hum Mol Genet 2006, 15:1329-1341 Watanabe TK, Katagiri T, Suzuki M, Shimizu F, Fujiwara T, Kanemoto N, Nakamura Y, Hirai Y, Maekawa H, Takahashi E: Cloning and characterization ... were compared and analyzed by a variety of subtractive computer-based approaches Integrated programs for accuracy analyzed all proteins by calculating means and http://www.translational-medicine.com/content/7/1/75...

Ngày tải lên: 18/06/2014, 15:20

24 507 0
báo cáo hóa học:" Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma" docx

báo cáo hóa học:" Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma" docx

... squamous cell carcinoma Acta Otolaryngol 2005, 125:779-785 Bahnassy AA, Zekri AR, Abdallah S, El-Shehaby AM, Sherif GM: Human papillomavirus infection in Egyptian esophageal carcinoma: correlation ... 46:2074-2079 Wagayama H, Shiraki K, Sugimoto K, Ito T, Fujikawa K, Yamanaka T, Takase K, Nakano T: High expression of p21WAF1/CIP1 is correlated with human hepatocellular carcinoma in patients with hepatitis ... Katayama A, Imada M, Nonaka S, Harabuchi Y: Loss of p21 expression is associated with p53 mutations and increased cell proliferation and p27 expression is associated with apoptosis in maxillary...

Ngày tải lên: 18/06/2014, 15:20

8 611 0
báo cáo hóa học: " Leader (L) and L* proteins of Theiler''''s murine encephalomyelitis virus (TMEV) and their regulation of the virus'''' biological activities" docx

báo cáo hóa học: " Leader (L) and L* proteins of Theiler''''s murine encephalomyelitis virus (TMEV) and their regulation of the virus'''' biological activities" docx

... of Health, Labor and Welfare, a Grant for Project Research from High-Technology Center of Kanazawa Medical University (H2005-7), and a Grant for Promoted Research from Kanazawa Medical University ... P388D1 cells The activity of caspase-3 was raised in the control cells and was inhibited by a caspase family inhibitor, Z-VAD-FMK, whereas caspase activity was significantly decreased in L*-expressing ... DA strain [29] From these data, it appears likely that macrophages are the major cells containing persistent viral genome Therefore, the mecha- nism by which DA survives in macrophages may clarify...

Ngày tải lên: 19/06/2014, 22:20

8 447 0
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

... Biomedical Laboratories, Piscataway, NJ) according to the manufacturer's protocol Absorbance at 450 nm was read using the BIO-TEK PowerWave XS microplate reader (Tecan US, Durham, NC) and the data was ... virus at a multiplicity of infection (MOI) of for 24 h (A) or 48 h (B) as indicated Data are shown as means ± standard errors (SE) of the means lamellar inclusion bodies, maintain functional characteristics ... were evaluated by Mann-Whitney U test and noted as significant as denoted by an asterisk Data are shown as means ± standard errors (SE) of the means Page of 11 (page number not for citation purposes)...

Ngày tải lên: 20/06/2014, 01:20

11 435 0
Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot

Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot

... immunosorbent assay (ELISA) (IgG, CV 2.6%), anti-Sm ELISA, anti-dsDNA radioimmunoassay (RIA) (Farr assay) and anti-dsDNA ELISA are commercially available assays from EUROIMMIUN and were performed ... Rheumatology; ANA, antinuclear antibody; SLEDAI, Systemic Lupus Erythematosus Disease Activity Index; ALT, alanine aminotransferase; AST, aspartate aminotransferase; GGT, g-glutamyl transpeptidase; ... effects, hematologic malignancies and other factors Another remarkable, significant clinical laboratory association was that aRibPR1+ patients had an elevated GGT value The participation of aRibPs...

Ngày tải lên: 12/08/2014, 15:22

11 415 0
Báo cáo y học: "Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element" doc

Báo cáo y học: "Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element" doc

... mouse mammary tumor virus spread within the mammary gland J Immunol 1998, 161:2375–2382 Zapata-Benavides P, Saavedra-Alonso S, Zamora-Avila D, VargasRodarte C, Barrera-Rodriguez R, Salinas-Silva J, ... Cytoplasmic extracts were prepared and analyzed for Renilla luciferase (Rluc) activity Average luciferase values for each reporter plasmid in the absence of Rev or Rem have been assigned a value ... or gapdh [5] (Figure 7C) PCRs without added reverse transcriptase showed that DNA contamination was absent (data not shown) Cytoplasmic RNA levels then were quantitated using ImageJ software after...

Ngày tải lên: 13/08/2014, 05:21

13 246 0
Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

... pETpol3 was made alike with #1219 (5'gttatgtgcatatgtgtaataccaaaaaacc) and #1413(5'tgcgctctcgagatttttttccaaatg) All plasmids were sequenced in their FV parts to verify correct insertions and to exclude ... polymerase, and NdeI treatment The PFV pol domain encoding the 85 kD PR, RT, and RNaseH subunits was amplified with primers #1217 (5'tc cacatatgaatcctcttcagctgttacagccgc) and #1414 (5'tattacactcgagcacataacttccttg), ... AdeI, T4 DNA polymerase treatment, and recutting with NdeI A 1.9 kb gag gene (aa 1–625 of 648 aa) was inserted into pET22b (Novagen) inframe to the C-terminal histidine tag after SacI, T4 DNA...

Ngày tải lên: 13/08/2014, 09:21

7 318 0
Báo cáo y học: "Phylogenetic and structural analysis of centromeric DNA and kinetochore proteins" doc

Báo cáo y học: "Phylogenetic and structural analysis of centromeric DNA and kinetochore proteins" doc

... 27 TCAC TG TCAC TG A G 5? 6 bits Saccharomyces bayanus Magnaporthe grisea Neurospora crassa 3? interactions Saccharomyces mikatae 1 Saccharomyces paradoxus Saccharomycotina Candida albicans 3? ... budding yeast Candida albicans and fission yeast Schizosaccharomyces pombe, plants such as Arabidopsis thaliana, and metazoans such as Drosophila melanogaster and Homo sapiens, are longer and more ... Saccharomyces paradoxus Saccharomyces cerevisiae Candida glabrata refereed research bits A T >86% 2 Candida glabrata T 5? 83-86 bp A T A C bits G A G + + AT content TCAC TG - S paradoxus CDEIII...

Ngày tải lên: 14/08/2014, 16:21

21 384 0
Studies on interactions between HCRSV coat protein and host proteins from kenaf

Studies on interactions between HCRSV coat protein and host proteins from kenaf

... Tomato mosaic virus TuMV Turnip mosaic virus ZYMV Zucchini yellow mosaic virus Other abbreviations: aa amino acid(s) AD activating domain Aux/IAA auxin/indole acetic acid AOX alternative oxidase ... cell death It was demonstrated that H2O2 accumulated locally and systemically in Cauliflower mosaic virus (CaMV) but not in mock-inoculated Arabidopsis thaliana And H2O2 accumulation was abolished ... cDNA sequence obtained 133 xiii ABBREVIATIONS Abbreviations used for plant viruses AMV Alfalfa mosaic virus BMV Brome mosaic virus CaLCuV Cabbage leaf curl virus CaMV Cauliflower mosaic...

Ngày tải lên: 11/09/2015, 10:17

190 380 0
X ray crystallographic study of yeast dcp1 and dcp2 proteins insights into the mechanism and regulation of eukaryotic mRNA decapping

X ray crystallographic study of yeast dcp1 and dcp2 proteins insights into the mechanism and regulation of eukaryotic mRNA decapping

... CATTGGTTTTATGAAGATGCTATACGTGCGCAAAACGA 35 F4 8A- R TCGTTTTGCGCACGTATAGCATCTTCATAAAACCAATG Y9 2A- F TTTGATGATTTTTTAGCATATAAGACTCGTATTCCTGT Y9 2A- R ACAGGAATACGAGTCTTATATGCTAAAAAATCATCAAA K9 3A- F GATGATTTTTTACGATATGCGACTCGTATTCCTGTCCG ... Q3 7A- F GTTGAACGACTTTGTTTTGCAATCGAACAAGCTCATTG Q3 7A- R CAATGAGCTTGTTCGATTGCAAAACAAAGTCGTTCAAC E3 9A- F CGACTTTGTTTTCAAATCGCACAAGCTCATTGGTTTTA E3 9A- R TAAAACCAATGAGCTTGTGCGATTTGAAAACAAAGTCG W4 3A- F CAAATCGAACAAGCTCATGCGTTTTATGAAGATTTTAT ... W4 3A- F CAAATCGAACAAGCTCATGCGTTTTATGAAGATTTTAT W4 3A- R ATAAAATCTTCATAAAACGCATGAGCTTGTTCGATTTG F4 4A- F ATCGAACAAGCTCATTGGGCTTATGAAGATTTTATACG F4 4A- R CGTATAAAATCTTCATAAGCCCAATGAGCTTGTTCGAT F4 8A- F CATTGGTTTTATGAAGATGCTATACGTGCGCAAAACGA...

Ngày tải lên: 14/09/2015, 12:28

125 343 0
Crystallization trials of refolded breast tumor kinase (BRK) and peroxisome proteins

Crystallization trials of refolded breast tumor kinase (BRK) and peroxisome proteins

... cell and lattices A crystal (Fig 1.1) consists of a large number of molecules, which are arranged in a particular manner Figure 1.1 A single protein crystal (adapted from Mathias Klod) A regular ... by all atoms in the crystal, governed by a set of parallel and equally spaced planes that slice all unit-cells in that particular orientation According to Bragg’s law when X-rays with a wavelength ... the Src family PTKs, these domains are involved in both intermolecular associations that regulate signaling cascades, and intramolecular associations that autoregulate protein kinase activity...

Ngày tải lên: 04/10/2015, 10:24

74 255 0

Bạn có muốn tìm thêm với từ khóa:

w