effective use of manure as a soil resource

... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... neither waste nor asset (Dittrich, 1993) Manure was largely viewed as a farm asset up until the early 1960s At that time the theme of manure as a waste, as something to be disposed of, began to ... capacity as a standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders...

Ngày tải lên: 16/03/2014, 11:44

... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy ... ketamine is being used increasingly as a recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware of the problem and ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table...

Ngày tải lên: 11/08/2014, 21:22

... the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital status, educational level ... activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities ... sex, martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher...

Ngày tải lên: 18/06/2014, 19:20

... languages and in interlanguage of English learners of different language backgrounds such as House and Kasper (1981), Tracy, Van Dusen, and Robison (1987), Tracy and Eisenberg (1990), Wajnryb ... contrastive analysis (CA), and survey questionnaires It also deals with informants and procedures of the data collection Chapter 4: Data analysis and findings: This chapter analyses collected data to ... Research Articles Amsterdam/ Philadelphia: John Benjamins Publishing Company 22 James, C (1983) Contrastive Analysis Essex: Longman Group Ltd 23 Kasper, G (1992) Pragmatic transfer Second Language...

Ngày tải lên: 10/08/2015, 19:46

... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, ... describes and analyzes the syntactic and pragmatic features of 2.2.2.2 Classifications of speech acts directives in English and Vietnamese Searle (1975) has set up the following classification of Trương...

Ngày tải lên: 26/11/2013, 13:31

... through a part of a disease trajectory Within nursing, Case Management has been developed and can be divided into three generations [27] As a third generation Case Manager, the NN’s approach to patients ... phase of the disease and while waiting for primary cancer treatment Methods A qualitative study was found appropriate as experiences and meanings were desired, and limited knowledge of this area ... 21 participants with a range of characteristics including age (median age 63 (range 36–79)), marital status, place of residence and gynecological diagnosis (Table 1) All characteristics in Table...

Ngày tải lên: 13/02/2014, 06:20

... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...

Ngày tải lên: 17/02/2014, 19:20

... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...

Ngày tải lên: 20/02/2014, 11:21

... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... of a transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear...

Ngày tải lên: 07/03/2014, 02:20

... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... )346/)214 Total chromatin (lanes and 10), and no DNA (lanes and 6) were used as positive and negative PCR controls As a marker (lane M), the 100-bp gene ruler (Fermentas) was used isoforms Furthermore,...

Ngày tải lên: 07/03/2014, 15:20

Ngày tải lên: 08/03/2014, 20:20

... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt, ... 10)4 s)1 Rmax values decreased, as expected, with increasing baseline A dissociation constant of 64 nm for the GABARAP–CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology ... Eswar N, Braberg H, Madhusudhan MS, Davis FP, Stuart AC, Mirkovic N, Rossi A, MartiRenom MA, Fiser A et al (2004) MODBASE, a database of annotated comparative protein structure models, and associated...

Ngày tải lên: 16/03/2014, 05:20

... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... protein was precipitated and washed carefully with methanol–chloroform [31] The protein concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation...

Ngày tải lên: 23/03/2014, 15:20

... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...

Ngày tải lên: 25/03/2014, 10:41

... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identification of the reaction ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...

Ngày tải lên: 30/03/2014, 15:20

... the word alignments for arbitrary language pairs 23 tory particles, adverbial particles, binding particles, conjunctive particles, and phrasal particles Japanese grammar also uses auxiliary verbs ... syntactic features of a word/phrase, as well as a representation of their semantic content Phrases and words represented by signs are collected into larger phrases by the applications of schemata The ... Asia References David Chiang 2005 A hierarchical phrase-based model for statistical machine translation In Proceedings of ACL, pages 263–270, Ann Arbor, MI David Chiang 2010 Learning to translate...

Ngày tải lên: 30/03/2014, 21:20

... phrases In contrast to Utiyama and Isahara (2007), we employ a large number of intermediate languages and demonstrate how triangulated phrase-tables can be combined with standard phrase-tables ... and a generally easier translation task, as well as a better preservation of information between aligned phrases Using a single language for triangulation clearly improves performance, but can ... additional useful translation information We now assess the phrase-table quality more directly Comparative statistics of a standard and a triangulated phrase-table are given in Table The coverage...

Ngày tải lên: 31/03/2014, 01:20

... elemental analysis of samples Sample EF FW Table Elemental analysis of graphite and graphite-g-TMPBA Sample Elemental analysis Elemental analysis C (%) H (%) C (%) O (%) As- received graphite Pyrene ... 700 amu The covalent attachment of TMPBA onto pyrene could be confirmed by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) analysis (Fig 2) A series of peak groups appeared, ... the purpose of having a basic understanding of the starting material, pristine graphite was characterized by elemental analysis (Table 2) When theoretical C H N O contents were calculated, the...

Ngày tải lên: 21/06/2014, 17:20

... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s ... Polish Acad Sci Math 51 (2003), no 2, 147–156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (1993), no 3, 819–821 S Prieß-Crampe, Der Banachsche...

Ngày tải lên: 23/06/2014, 00:20

... that in writing of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft! Perhaps not; and yet I would rather...

Ngày tải lên: 28/06/2014, 17:21