education awareness and workforce planning are a key challenge

Providing Effective Financial Aid Assistance to Students from Foster Care and Unaccompanied Homeless Youth: A Key to Higher Education Access and Success pdf

Providing Effective Financial Aid Assistance to Students from Foster Care and Unaccompanied Homeless Youth: A Key to Higher Education Access and Success pdf

... then adopted by her aunt Siesha should answer “yes” because both parents are deceased and she was adopted after age 13 Part B: Foster Care Case Scenarios The 2011-12 FSA AVG indicates that a student ... was 16 Siesha was then adopted by her aunt Siesha should answer “yes” because both of her parents are deceased and she was adopted after age 13 Scenario G Peter was adopted as an infant His adoptive ... 2011-2012 FAFSA) According to the 2011–12 FSA Application and Verification Guide (AVG), a foster parent or a legal guardian is not treated as a parent for FSA purposes In addition the AVG states,...

Ngày tải lên: 15/03/2014, 19:20

40 355 0
Tài liệu Adult environmental education: awareness and environmental action pdf

Tài liệu Adult environmental education: awareness and environmental action pdf

... Hamburg and Secretary General of CONFINTEA Adult environmental education: awareness and environmental action I n t ro d u c t i o n The central aim of the workshop “Adult environmental education; ... long-term planning, commitment and global approaches Adult education has often included a political and socially transformative perspective Since Paulo Freire’s work on literacy and its emancipatory ... both national and international levels National and international NGOs can be important partners in this process Environmental education: a central theme for adult education The integration of...

Ngày tải lên: 14/02/2014, 13:20

15 419 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... wild-type and ‘not detectable’ for W14 0A and W140O) Flanagan et al [15] reported that multiple mutations can cause large changes in the average conformation of denatured proteins Here we show that a ... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot

... whole hand/foot image and inferred assignment) ranged for all readers from 70% to 75% The percentages of cases falsely classified as having repair ranged from 1.5% to 5%, and those of cases falsely ... L, van der Heijde D, de Jager JP, Gough A, Kalden J, Malaise M, Martin Mola E, Pavelka K, Sany J, Settas J, et al.: Therapeutic effect of the combination of etanercept and methotrexate compared ... indicated that readers were able to accurately recognize a single feature or a combination of features that was interpreted as repair in many cases Assignment of the correct sequence was significantly...

Ngày tải lên: 09/08/2014, 10:20

9 374 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... correspond to any annotated small RNA Our small RNA cloning strategy only captures small RNAs that are, as miRNAs, 5’-phosphorylated and, Page of 13 thus, eliminates RNA degradation products generated ... non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads that did not match any of those ... non-coding RNA annotations (ncRNA.org) Read counts correspond to undifferentiated (ND.1 and ND.2), day differentiated (AD3.1 and AD3.2) and day differentiated (AD8.1 and AD8.2) hMADS cell samples,...

Ngày tải lên: 09/08/2014, 23:20

13 365 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

... significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate that a large number of SARS ... RW, Obias-Manno D, Barker AH, Arensberg D, Baker A, Friedman L, Greene HL, Huther ML, and the CAST investigators: Mortality and morbidity in patients receiving encainide, flecainide, or placebo ... DiazGranados N, Al-Saidi F, Cooper AB, Guest CB, Mazer CD, Mehta S, Stewart TE, Barr A, Cook D, Slutsky AS; Canadian Critical Care Trials Group: One year outcomes in survivors of the acute respiratory...

Ngày tải lên: 12/08/2014, 20:20

3 355 0
Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

... Island, USA 2Zambarano Unit, Eleanor Slater Hospital, Cranston, Rhode Island, USA 3Center for Delivery, Organization, and Markets, Agency for Healthcare Research and Quality, Rockville, MD, USA ... newborns and 80 percent of all other neonatal and pediatric stays are randomly selected Weights are provided to allow the calculation of national estimates of hospitalizations in short-term, acute care ... this analysis lie in the large database, the probability based sampling, and the standardized methodology of the tri-annual data As with other administrative measures of disease, hospital discharge...

Ngày tải lên: 13/08/2014, 18:22

9 449 0
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... standards have been adopted by more than 74 countries as national standards for quality assurance The representative of ISO for the USA is the American National Standards Institute (ANSI) and ... with traditional educational management A slow model (planning in 5-6 years) is very slow to progress a strategic planning since there are many objectives and subjective factors that make a planning...

Ngày tải lên: 05/03/2014, 14:20

12 542 0
Workforce Planning and Development Processes - A Practical Guide ppt

Workforce Planning and Development Processes - A Practical Guide ppt

... the administrative assistance of Louis Ramirez xv Abbreviations AAC Air Armament Center AAC/CC Commander, Air Armament Center AF /A1 M Air Force Directorate of Manpower and Organization AFMC Air ... centers and laboratory directorates – builds and maintains database of job background requirements and makes the data accessible to centers and laboratory directorates • centers and laboratory ... functional managers for logistics, financial management, program management, and engineering and sciences (formerly LG, PK, FM, and EN); Aeronautical Systems Center; and Air Armament Center (AAC)...

Ngày tải lên: 06/03/2014, 20:20

70 493 0
Tài liệu Assessing Financing, Education, Management and Policy Context for Strategic Planning of Human Resources for Health pdf

Tài liệu Assessing Financing, Education, Management and Policy Context for Strategic Planning of Human Resources for Health pdf

... Indicator: • World Bank (2003) (adapted) Benchmark: • Ideal Performance appraisal is an important part of personnel administration, and accessible, accurate and up-todate guidelines are necessary ... international and national experts It is expected that data availability and quality will, to a large degree, drive the final choice of indicators While quantitative indicators facilitate eventual ... through internationally-accessible databases or in-country databases • Geographical distribution: salary level Average salary ratio in rural : urban areas, by HRH category None None Benchmark types:...

Ngày tải lên: 14/02/2014, 09:20

90 402 0
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... were carried out with the jnet [24] or the predictprotein (prof) [11] algorithms 10 Statistical analysis Results (Figs and 2) are expressed as the mean ± SEM and were compared by one-way anova using ... be either acidic or basic), properties that also characterize the natural granule-sorting helices of PC1 ⁄ 3, PC2 and PC5 ⁄ 6A Previous reports have suggested that PC1 ⁄ and PC2 associate with...

Ngày tải lên: 18/02/2014, 16:20

9 600 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA ... ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC In light ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* ... pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )140 to )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Creating a National Infrastructure Bank and Infrastructure Planning Council pot

Creating a National Infrastructure Bank and Infrastructure Planning Council pot

... for American Progress  |  Creating a National Infrastructure Bank and Infrastructure Planning Council 32 Mallett, Maguire, and Kosar, “National Infrastructure Bank: Overview and Current Legislation.” ... new and valuable national assets but also create thousands of jobs and promote environmentally sustainable development 16  Center for American Progress  |  Creating a National Infrastructure Bank ... a single table, we can finally develop and pursue coordinated approaches to overarching national problems such as road congestion and electrical grid reliability A national infrastructure planning...

Ngày tải lên: 06/03/2014, 10:20

31 295 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

... (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification ... template and then sequenced Finally, two cDNAs were obtained and designated HRT1 and HRT2, respectively DNA sequencing analysis Materials and methods Plant materials and RNA isolation Latex and various ... AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to GenbankTM and DDBJ by Coldren et al and Sando et al respectively)...

Ngày tải lên: 07/03/2014, 21:20

10 517 0
a study on awareness and implementation of csr in a multinational companies operating in vietnam

a study on awareness and implementation of csr in a multinational companies operating in vietnam

... organizations and political economy in the world WTO, ASEAN has attracted many investors and business organizations to operate in Vietnam that CSR is familiar with them Their awareness can be ... Vietnam economy, it has attracted many multinational companies to operate in Vietnam such as Dutch Lady, Honda, Vedan Although they are multinational companies but their adoption and implementation ... obtain secondary data However, secondary data has disadvantage, which is that the information may be not available Thus, if the researchers want to get effective secondary data, they must evaluate...

Ngày tải lên: 13/03/2014, 14:19

91 795 1
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam

research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam

... water and waste was mixed colors, and flows into the Dong Nai river People living around said that the sewage canals have a black color and a very unpleasant odor Sadly, this is a company specializing ... journals, newspaper Comparing with primary data, there are 34 may be more quickly and lower cost to obtain the secondary data However, there are some disadvantages regarding to secondary data that ... performance The managers of multinational companies have more advantages than the managers of Vietnam, they have more conditions to awareness of CSR Some managers of business in Vietnam are not...

Ngày tải lên: 13/03/2014, 14:20

73 706 2
Testimony of the American Association of Colleges of Pharmacy Senate Committee on Health, Education, Labor, and Pensions (HELP) “Addressing Health Care Workforce Issues for the Future” February 12, 2008 pptx

Testimony of the American Association of Colleges of Pharmacy Senate Committee on Health, Education, Labor, and Pensions (HELP) “Addressing Health Care Workforce Issues for the Future” February 12, 2008 pptx

... compromised and new approaches, such as team-based care, should be supported as a way to extend the health care team so high quality care and consistent messages of health and wellness can be delivered ... Health About AACP Founded in 1900, the American Association of Colleges of Pharmacy (AACP) is a national organization representing the interests of pharmacy education and educators Comprising all ... primary investigators; interdisciplinary and interprofessional grant programs; the Clinical and Translational Science Awards (CTSA) programs; and the creation of the Council of Councils and the...

Ngày tải lên: 14/03/2014, 21:20

6 379 0
Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

... Shioda T, Kato H, Ohnishi Y, Tashiro K, Ikegawa M, Nakayama EE, Hu H, Kato A, Sakai Y, Liu H et al (1998) Anti-HIV-1 and chemotactic activities of human stromal cell-derived factor 1alpha (SDF-1alpha) ... C (2010) Natriuretic peptide system and cardiovascular disease Heart Views 11, 10–15 Sonoyama T, Tamura N, Miyashita K, Park K, Oyamada N, Taura D, Inuzuka M, Fukunaga Y, Sone M & Nakao K (2009) ... supplementary material is available: Fig S1 Representative MALDI-TOF MS analyses of VIP and glucagon incubation with FAP and DPP4 Fig S2 Representative MALDI-TOF MS analyses of PACAP and oxyntomodulin...

Ngày tải lên: 14/03/2014, 23:20

17 425 0
You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

... you had in mind You Are a Brand! will make the principles of branding available to you In many ways, brands are like people: They have qualities, attributes, and personalities And people are like ... meant to be Branding is a great tool for both, because it makes you an active partner in your business and in your life destiny You Are a Brand! will teach you selfbranding strategies and career ... thanks, Dad PART Brand Strategy: Finding Your Self-Brand Idea CHAPTER Take Charge of Your Self-Brand And say to all the world, “This was a man.” William Shakespeare Julius Caesar (V, 5) In 64...

Ngày tải lên: 15/03/2014, 23:28

733 532 0
w