... 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG ... Reverse Forward Reverse Reverse Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG ... 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18...
Ngày tải lên: 19/02/2014, 16:20
... Chemicals were treated for 30 days via gavages to week old female SD rats Values are the mean ± SD (n = 3) ALT: alanine aminotransferase, AST: aspartate aminotransferase, ALP: alkaline phosphatase ... aminotransferase (ALT), aspirate aminotransferase (AST) and alkaline phosphatase (ALP) in serum were determined using a commercial kit (Bayer, Germany) and a blood chemical analyzer (Express 550 ... Ciba Corning, USA) Animals and housing Eight-week-old female Slc : SD rats (SLC, Japan) were provided with tap water and commercial diet ad libitum The animal room was maintained at a temperature...
Ngày tải lên: 07/08/2014, 20:23
báo cáo khoa học: "Correction: Endocarditis caused by methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report" ppt
... Endocarditis caused by methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report Beatriz Perazzi1*, Natalia Bello2, Marta Mollerach3, Carlos Vay1, Mar a ... Buenos Aires Argentina Email BP - hugodandrea@ciudad.com.ar; NB - nataliasbello@yahoo.com.ar; MM martamollerach@gmail.com; CV - cavay@fibertel.com.ar; MBL - mblasala@fibertel.com.ar; AF famiglie@ffyb.uba.ar ... Aires Córdoba 2351, Capital Federal City of Buenos Aires Argentina Division of Infectious Diseases Hospital de Clinicas Faculty of Medicine University of Buenos Aires Córdoba 2351, Capital Federal...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: "Endocarditis caused by methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report" pps
... Population analysis of isolates SA1, SA2, SA3, S aureus ATCC 29213 (VSSA), S aureus Mu3 (hVISA) and S aureus Mu50 (VISA), assessed by susceptibility to vancomycin AUC ratio of 0.83, compared to ... Aritaka N, Hanaki H, Kawasaki S, Hosoda Y, Hori S, Fukuchi Y, Kobayashi I: Dissemination in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to vancomycin Lancet 1997, ... iliopsoas muscle involvement The transesophageal echocardiogram (TEE) performed 48 hours after admission showed a mass compatible with vegetation and an anterior mitral valve leaflet abscess causing...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: "A clay-shoveler''''s fracture with renal transplantation and osteoporosis: a case report" doc
... bearing heavy weights There was also a history of night pains at the cervicodorsal site and pain and paresthesia of the upper extremity and chest Neurological examination was normal There was ... further symptoms This case indicates that it is not possible for a patient with osteoporosis and Clay-shoveler 's fracture to bear weight within 12 months of the fracture These injuries are known to ... fracture of the cervicodorsal aspect of the spinous processes This was successfully treated with a cervical collar, alendronate and long-term rest, to the extent that the patient was able to...
Ngày tải lên: 11/08/2014, 23:21
Pioneer Introduces the New CYBER NAVI Car Navigation system in Japan With the world’s first* Head-Up Display to project augmented reality information in front of the windscreen* pot
... users who want to always have the latest map data, with map data updates with no additional fee for the first three years, and a Road Creator function that automatically generates road data when ... (class or higher), sold separately *9: Only ‘road data’ and ‘map data’ Maps cannot be updated via mobile phones *10: This system applies to all roads except for narrow laneways that are less than ... via an SD card*8 Map data can also be updated via the communications module*9, so that users can enjoy comfortable driving by always using the latest maps 7) A Road Creator function that automatically...
Ngày tải lên: 07/03/2014, 11:20
From the Earth’s Core to Outer Space docx
... (Yilgarn craton of Australia and Dharwar craton of India) At about 2.45 Ga the Nena cratons of Laurentia and Baltica lie near the equator whereas the Ur cratons of Australia and especially India are ... comprises Laurentia, Baltica, Amazonia, Australia, Siberia, India and North China We suggest that the core of the Nuna was formed by elongated huge Laurentia-Baltica-Amazonia landmass Australia was ... reconstruction Laurentia (Superior) Baltica (Karelia) Amazonia Australia (WA) Siberia (Akitkan) Kalahari 1.78 Ga reconstruction Laurentia (Churchill) Baltica (Karelia) Amazonia Australia (NA) Kalahari...
Ngày tải lên: 14/03/2014, 10:20
WORKING PAPER SERIES NO 1471 / SEPTEMBER 2012: FEEDBACK TO THE ECB’S MONETARY ANALYSIS THE BANK OF RUSSIA’S EXPERIENCE WITH SOME KEY TOOLS pdf
... unrestricted constant and seasonal dummy variables The results are shown in Table 25 Table Cointegration vectors (t-statistics) Variable M Estimation method S2 S FM-OLS S2 S Y FM-OLS S2 S W FM-OLS S2 S ... money as transactions in asset markets increased The increase in wealth due to the growth of asset prices may also be associated with increased demand for other liquid assets (including money) that ... significantly The analysis of causes and consequences of these deviations provides valuable information and is part of the analytical work in the area of monetary analysis At this stage the aspects...
Ngày tải lên: 22/03/2014, 21:20
Additional Measures Needed to Assess 7(a) Loan Program’s Performance potx
... capital and to have limited opportunities for small business ownership (such as African Americans, American Indians, Alaska Natives, Hispanics, Asians, and women) and those that are in certain ... veterans, handicapped individuals, women, African Americans, Hispanics, Native Americans, and Asians The 7 (a) program also includes provisions for extending financial assistance to small businesses ... start-up small businesses assisted, number of new loans approved to existing small businesses, number of new loans funded to existing small businesses, number of existing small businesses assisted,...
Ngày tải lên: 23/03/2014, 04:21
TECHNICAL GUIDELINES (WATER MANAGEMENT CONCEPT) FOR PAPER MAKERS IN EUROPEAN REGIONS WITH DIFFICULT BOUNDARY CONDITIONS ON HOW TO OPERATE MILLS WITH MINIMUM WATER USE pdf
... 1999, S 153-162 BIENER R., MEIERS R., KUSSI J. -S and H LEIMKÜHLER: Systematische Reduktion des Wasserverbrauchs und des Abwasseranfalls, 1999 GVC-Abwasser-Kongress Verfahrenstechnik der Abwasser ... a detailed and specific analysis of the fresh water used by the paper machine To minimise fresh water use and its drawbacks, a combination of the above list is required: Adequate storage capacity ... content are essential to use process water instead of fresh water for applications such as paper machine showers Backward re-use process water in the systems, counter current to the fibre flow should...
Ngày tải lên: 01/04/2014, 00:20
langford’s starting photography the guide to great images with digital or film
... Photography (Aust.) He is an Alpha/Beta tester for Adobe digital photography products and acts as an Adobe Ambassador for Australia and New Zealand He is an accomplished teacher/demonstrator who, ... Photography at Birmingham College for Art and Design He served as an external assessor for several BA courses, as well as an adviser to national examination boards for photography at school and college ... Michael started his career at the age of 16, as a photographer s apprentice, was later assigned to the RAF Photographic Section, worked with a press photography firm and as an industrial photographer...
Ngày tải lên: 01/06/2014, 10:31
Báo cáo hóa học: " Research Article A Generalized Wirtinger’s Inequality with Applications to a Class of Ordinary Differential Equations" docx
... nonautonomous delay differential equation 1.2 has been done to the best of the author knowledge Motivated by these cases, as a part of this paper, we study the estimates of periods of periodic solutions ... Nonlinear Analysis: Theory, Methods & Applications, vol 31, no 1-2, pp 45–54, 1998 10 J Llibre and A. -A Tarta, “Periodic solutions of delay equations with three delays via bi-Hamiltonian ¸ systems,” ... Journal of Inequalities and Applications Acknowledgments The authors would like to thank the referee for careful reading of the paper and many valuable suggestions Supported by the specialized Research...
Ngày tải lên: 22/06/2014, 02:20
báo cáo khoa học: " Bundling occupational safety with harm reduction information as a feasible method for improving police receptiveness to syringe access programs: evidence from three U.S. cities" ppt
... primary modality for disease transmission among injection drug users (IDUs) [1,2] Many states and localities have implemented syringe access programs (SAPs) to reduce the sharing of syringes, ... enrolled IDUs are arrested on charges other than paraphernalia and found to be in possession of syringes, those syringes are placed in appropriate disposal containers, which are gathered periodically ... Ditzler A: State syringe and drug possession laws potentially influencing safe syringe disposal by injection drug users J Am Pharm Assoc (Wash) 2002, 42 :S9 4-98 Small D: Two cultures passing in...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: " Randomized controlled trials are needed to determine appropriate blood transfusion strategies in patients with acute coronary syndromes" pdf
... transfusion is at least as safe and possibly safer than a more liberal transfusion strategy when applied to a general population of ICU patients [2] The restrictive strategy sought to maintain ... appears to be safe in most critically ill patients with cardiovascular disease, with the possible exception of patients with acute myocardial infarction and unstable angina [3] Others studies have ... stable patients with ischemic heart disease PARAGON [9]) They found that transfusion was associated with an increased hazard for death within a 30-day interval and that the odds of death were higher...
Ngày tải lên: 12/08/2014, 22:21
earth science changes to earth''s surface
... northeastern United States in June In 1883 Krakatoa erupted in Indonesia This volcano caused huge waves called tsunamis in Earth s oceans Earthquakes can also cause tsunamis Tsunamis can lead to landslides ... Earth s landforms So landslides, earthquakes, and volcanoes Earth s surface will always be changing The Cause of Earthquakes A fault is a break or crack in rocks where Earth s crust can move Rocks ... layer called the crust The crust is underwater in the ocean Earth s crust has many natural features Each one is called a landform Landforms are many sizes and shapes Plains are flat landforms...
Ngày tải lên: 28/01/2015, 15:30
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and Quade (1985), systems analysis is interchangeably termed as policy analysis in the US and operational analysis ... various scientific disciplines and/or stakeholders, in such a manner that integrated insights are made available to responsible decision-makers Van Asselt also mentions that: Integrated assessments ... open systems are: groundwater systems, social systems, as well as most of the natural systems Four types of variables characterize a model of a system (Kramer and De Smit, 1991): input variables,...
Ngày tải lên: 06/11/2012, 10:35
Cook, Claire Kehrwald - The MLA's Line by Line, How to Edit Your Own Writing (1985)
... reference guides, and research summaries but also press releases and promotional material, business articles, technical manuals, trade books, and textbooks in such diverse fields as mathematics, engineering, ... be careful: not all of phrases translate into possessives If, for example, you change the assassination of the dictator to the dictator 's assassination, you risk turning the victim into a murderer.) ... cons make an assessment of, assess; is capable of, can; make use of, use; is of to, interests; and is a benefit to, benefits If you check your sentences for LOOSE, BAGGY SENTENCES weak verbs and...
Ngày tải lên: 21/12/2012, 09:06
Thực trạng và giải pháp để xây dựng thương hiệu rau sạch của Doanh nghiÖp s¶n xuÊt rau an toµn Méc Ch©u
... ng mua v s dng sn phm Sau s dng sn phm h s cú nhng cm giỏc nht nh nh thc s thớch thỳ hoc khụng hi lũng nh mong mun d Hnh vi sau mua Sau mua v s dng rau sch , ngi tiờu dựng s cm thy hi lũng hay ... ú l rau sch c s sn xut v chu trỏch nhim trc khỏch hng v mc an ton ca sn phm Doanh nghiệp s n xuất rau an to n Mộc Châu Doanh nghiệp chuyên sn xut rau qu sch vi nng sut cht lng cao Nhng Doanh ... bit: a. 1 Yu t sn phm: Sn phm chớnh hin m Doanh nghiệp cung cp cho th trng H Ni l rau qu sch, ú cú th to s khỏc bit v sn phm ca Doanh nghiệp so vi sn phm ca cỏc Doanh nghiệp sn xut rau sch hay...
Ngày tải lên: 19/04/2013, 00:07