... other reanalysis and data products as well as results on the variational approach The work is closed with a summary and conclusions A high-resolution regional reanalysis for Europe and Germany Every ... variables are staggered on an Arakawa-C-grid (Arakawa and Lamb, 1981; Arakawa and Lamb, 1977) where all scalar variables Ψ are defined in the grid centre at (i, j, k) whereas the components of ... Climate Forecasting System Reanalysis (CFSR, Saha et al., 2010), the Modern-Era Retrospective Analysis for Research and Applications (MERRA) by the National Aeronautics and Space Administration...
Ngày tải lên: 26/11/2015, 10:11
... investment, TRIPS, trade facilitation and customs, mutual recognition agreements, dispute settlement, labour rights, capacity building and sustainable development • Vietnam has similar trade in goods ... Source TASTE 2013 and simulations Rice exempt Industrial tariffs on Vietnam’s exports to EU Source TASTE 2013 and simulations Vietnam total exports relative to base Vietnam total imports relative ... commitments across agreements • Vietnam has tended to stick to its WTO accession protocol for services and shied away from other trade related areas Tariffs on Vietnam’s agricultural exports to...
Ngày tải lên: 23/06/2016, 00:18
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... significantly different basolateral ⁄ apical uptake ratio compared to the ratio obtained at h (data not shown) At 30 the basolateral ⁄ apical uptake ratio was 9.1 ± 3.7 and 5.2 ± 0.3 for 5-dayand ... (http://www.au.expasy.org/sprot/) for protein identification One missed cleavage was allowed, carbamidomethylation was set as a fixed modification and oxidation of methionine as a variable modification The ... and 72 h of labelling, apical (C) and basolateral (D) neonatal and postweaning pigs [60] The fact that this enzyme has a quite high turnover in the Caco-2 cells may indicate that a substantial...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Australia, its history and present condition ppt
... Outsettlers Islands on the Australian Coast Kangaroo Island Coral Reefs and Islets CHAPTER II CHAPTER II [Page 42.] Forbidding aspect of coast no argument against inland beauty and fertility River Darling ... that his spirits were always good And on another occasion, he shared the last remaining portion of provision with his native servant; after which he actually felt glad that it was gone, and that ... dotted about with many beautiful islands The water had a glassy and fairy-like appearance, and it was an imposing feeling to sit down alone on the lofty eminence, and survey the great lake on which...
Ngày tải lên: 20/02/2014, 08:20
Workforce Planning and Development Processes - A Practical Guide ppt
... individual, the AFSC, command level, organizational type and kind, unit, organizational structure name, location, and functional category Methods, Data, and Tools HQ AFMC already has access to military ... document Finally, we appreciate the editorial assistance of Shelly Wiseman and the administrative assistance of Louis Ramirez xv Abbreviations AAC Air Armament Center AAC/CC Commander, Air Armament ... Operations) in group-level and above organizations, functional AFSCs, functional codes, and major functional organizations (e.g., Air Intelligence Agency) Command experience was awarded according...
Ngày tải lên: 06/03/2014, 20:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of ... TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT...
Ngày tải lên: 07/03/2014, 16:20
history and development of higher education in india 1 5 ppt
Ngày tải lên: 09/03/2014, 17:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... furylacryloylLGPA was added to the hydrolysis reactions as an internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated ... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification...
Ngày tải lên: 23/03/2014, 09:20
japan its history and culture
... square miles in extent, the Nobi Plain around Nagoya, and the Kansai Plain around Nara, Kyoto, and Osaka at the eastern end of the Inland Sea The last two are each only about one-tenth the area ... rapidly and caught up with bronze in Japan Among the Yayoi archaeological remains are mirrors, bells, swords, and spears of bronze, the last being ceremonial weapons; but a few tools and actual ... weapons, pictures, musical instruments, and land and population registers of Japanese origin, as well as pottery and metal work from China, central Asia, and possibly Persia These translations are...
Ngày tải lên: 27/03/2014, 12:24
History and examination at a glance
... Cataloging-in-Publication Data Gleadle, Jonathan History and examination at a glance/Jonathan Gleadle p ; cm.Ð(At a glance) Includes index ISBN 0-632-05966-4 (alk.paper) Medical history takingÐHandbooks, manuals, ... may be helpful to examine with the arm elevated above the head and with the patient lying flat Palpate for axillary and supraclavicular lymphadenopathy 14 Obstetric history and examination History ... sex (vaginal, rectal, genitalia and female breast examination) Hand washing The hands of staff are the commonest vehicles by which microorganisms are transmitted between patients and hand washing...
Ngày tải lên: 23/05/2014, 23:04
images of empiricism essays on science and stances with a reply from bas van fraassen nov 2007
... same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private Limited, ... better on confirmational virtues Informational virtues are not always at the same time confirmational virtues (4) Since informational virtues are reasons for accepting a theory, reasons for acceptance ... can full belief be forced on an agnostic Note how far away we have moved from ‘arguments that ought to persuade any rational person to abandon realism’ On the contrary, we find van Fraassen claiming...
Ngày tải lên: 11/06/2014, 01:06
Design and development of a medical parallel robotfor cardiopulmonary resuscitation
... robotics, mechatronics, control, and automation at the University of Macau, Macao SAR, China He has authored or coauthored about 160 papers published in international journals and conference proceedings ... R Di Gregorio and V Parenti-Castelli, A translational 3-DOF parallel manipulator,” in Advances in Robot Kinematics: Analysis and Control, J Lenarcic and M L Husty, Eds Norwell, MA: Kluwer, 1998, ... kinematic analysis was performed and the manipulatorreachable workspace was generated by taking into account the physical constraints introduced by the rotational limits of universal joints and...
Ngày tải lên: 04/08/2014, 09:54
báo cáo khoa học: "The immunoregulatory mechanisms of carcinoma for its survival and development" docx
... expression in laryngeal and pharyngeal cancer and its healthy stroma with cancer relapse BMC Cancer 2009, 9:35 77 Fukuda M, Tanaka A, Hamao A, Suzuki S, Kusama K, Sakashita H: Expression of RCAS1 and ... M, Kase S, Kodani I, Watanabe M, Adachi H, Ito H: Expression of Fas and Fas ligand in human gastric adenomas and intestinal-type carcinomas: correlation with proliferation and apoptosis Gastric ... M, Akahori T, Hamada K, Kubo A, Kanehiro H, Nakamura S, Enomoto K, Yagita H, Azuma M, Nakajima Y: Clinical significance and therapeutic potential of the programmed death-1 ligand/programmed death-1...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf
... gratefully acknowledged Authors’ contributions FJ planned the analysis strategy, analyzed the data and drafted the article in collaboration at all stages with JW Both authors read and approved the final ... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage ... in continuous variables were tested with t-test and in categorical variables with c tests Mean (standard deviation) range: unless otherwise stated 2 01 Johnson and Wardle International Journal...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo sinh học: "Mapping Quantitative Trait Loci (QTL) in sheep. III. QTL for carcass composition traits derived from CT scans and aligned with a meta-assembly for sheep and cattle carcass QTL" pot
... MyoMAX on carcass lean and fat Proc N Z Soc Anim Prod 2008, 68:43-44 26 Raadsma HW, Thomson PC, Zenger KR, Cavanagh C, Lam MK, Jonas E, Jones M, Attard G, Palmer D, Nicholas FW: Mapping quantitative ... for growth and carcass traits in Japanese Black cattle by replication and identical-by-descent mapping Mamm Genome 2007, 18:125-136 68 Mizoshita K, Takano A, Watanabe T, Takasuga A, Sugimoto ... muscle area was estimated by averaging the area of muscle at the closest image to the first lumbar and the next caudal image Percentages of lean, fat and bone were calculated as a percentage of...
Ngày tải lên: 14/08/2014, 13:21
Trans regional communities and external coupling a geographical perspective on regional development of the chaoshan region, china
... communication, and innovation, and retained regional competitive advantage in a given global production filiere Some researchers conducted an analytical focus similar with organizational approaches, mainly ... regional collaborative networks and hence regional development Trans-regional community organizations on the one hand serve as an organizational channel for regional firms to deal with external ... social and institutional factors, such as international organizations, transnational communities, and state institutions By understanding regional development as a trans-regional interactive...
Ngày tải lên: 09/09/2015, 10:21
Hyperscsi design and development of a new protocol for storage networking
... has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A UDP datagram can be encapsulated in an IP packet ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical ... UDP/IP was used for data transportation with additional reliability function on top It assumed data in-order delivery and employed a fixed-size data transmission window and ACK control It also investigated...
Ngày tải lên: 16/09/2015, 15:54
Design and development of a self balancing bicycle using control moment gyro
... widely used as an actuator other than on large spacecraft to control the attitude of large spacecraft and space infrastructure such as the International Space Station [15] There are many reasons for ... (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; and ... wheels are the simplest and least expensive of all momentumexchange actuators Its advantages are low cost, simplicity, and the absence of ground reaction Its disadvantages are that it consumes...
Ngày tải lên: 02/10/2015, 17:14