... Park's transfonnation permits us to have a best knowledge of the non sinusoidal permanent magnet synchronous motor We are so able as well to analyse the classical control laws such as 120' voltage ... motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the new variables ... so reduce to a two-phase system in the "a- p" kame For a non-sinusoidal machine can be not equal to zero, and then a zero-sequence current can be useful The Conmrdia's transfonnation has no more...
Ngày tải lên: 03/01/2014, 19:50
... Centre Universitaire Larbi Ben M’hidi, e e Oum El Bouaghi 04000, Algeria E-mail address: af bouziani@hotmail.com Nabil Merazga: D´ partement de Math´ matiques, Centre Universitaire Larbi Ben M’hidi, ... with an integral condition for parabolic equations with a Bessel operator, Differ Uravn 27 (1991), no 12, 2094–2098 (Russian) A Bouziani, Mixed problem with integral condition for certain partial ... diffusion equation, Abstr Appl Anal 2003 (2003), no 16, 899–922 C V Pao, Dynamics of reaction-diffusion equations with nonlocal boundary conditions, Quart Appl Math 53 (1995), no 1, 173–186 , Asymptotic...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo sinh học: "Estimation of genetic parameters of egg production traits of laying hens by restricted maximum likelihood applied to a multiple-trait reduced animal model" pps
... multivariate analysis to a series of univariate analyses and consequently, drastically decreased computational costs These computational costs were also lowered by reducing the number of equations ... parents represented only 9% and 8% of the total number of animals, for strains A and B respectively, the reduced animal model (RAM) of (auaas and Pollak (1980) was used With RAM, all the equations ... a diagonal matrix whose elements n A c if both parents are known and 3/4 if one parent if known It was assumed that there is equal parental information for all nonparents and that parents are...
Ngày tải lên: 14/08/2014, 20:20
A Study on the Optimum Backwashing Method applied to Activated Carbon Process in Waterworks
... granular activated carbon-attached germs was 1.1ⅹ105∼5.8ⅹ108CFU/g, and granular activated carbon proved to be operated by BAC The number of spent carbon-attached, reactivated carbon-attached, and ... The quantity of germs attached to activated carbon A sample was picked by an activated carbon picker inserted, by less than 1m, into the filter layer of a granular activated carbon contact basin ... characteristics of a granular activated carbon In a granular activated carbon contact basin, virgin carbon is domestic activated carbon made from palm shell, reactivated carbon means activated carbon produced...
Ngày tải lên: 05/09/2013, 08:40
Towards a combined product - process approach TO DEVELOPING BUSINESS CORRESPONDENCE WRITING SKILLS FOR ENGLISH MAJORS IN HAIPHONG UNIVERSITY
... Product Approach, Process Approach and Genre Approach were reviewed and their advantages and drawbacks were drawn out so that suitable writing techniques can be picked up and inappropriate ones can ... the message across you want to get across) - Generating ideas and evaluation (assessing the draft and/or subsequent drafts) White and Arndt's model can be represented diagrammatically, as in Figure ... which manipulate relevant language forms and, finally, produce a short text To write in a particular genre, whether a formal report or a historical romance, the formal patterns that shape a text...
Ngày tải lên: 07/11/2012, 14:31
ELEGANT ANALYTICAL CHEMISTRY APPLIED TO ENVIRONMENTAL PROBLEMS - A PRACTICAL SYMPOSIUM ppt
... alone Aquatic Toxicity In conventional laboratory testing of toxicity to aquatic organisms care is taken to deliver a constant freely soluble aqueous concentration of test chemical to the organism ... organic material and can exhibit significantly less bioavailability than the molecular solutions employed in laboratory testing Body Burden and Bioconcentration Factor (BCF) An alternative approach, ... Extended Abstracts Vol 41 No practice, collection and sacrifice of organisms from the environment is not always feasible nor desirable There are several approaches that enable practical application...
Ngày tải lên: 05/03/2014, 21:20
System dynamics applied to project management: a survey, assessment, and directions for future research potx
... calibration to the plan and adds direct impacts Are both approaches acceptable? When is each approach preferable? There may also be some methodological (and perhaps legal) issues about the proper way to ... the adverse ripple effects of management actions CHANGE MANAGEMENT When customers make changes to projects, the original plan almost always becomes infeasible Change management entails pricing and ... behind and actions are taken to bring it back on schedule One significant contribution that system dynamics has, and can continue to make, is to convincingly persuade management that trying to achieve...
Ngày tải lên: 30/03/2014, 01:20
A virtual network organization business management model applied to retail banking
... data, and data collection procedures that are exacting in structure Finally, data analyses of the quantitative research method are primarily statistical, and the determination of value in analysis ... participants Use of the qualitative grounded theory design was also appropriate because data of the day -to- day experiences of managers and leaders in traditional and nontraditional retail banking, ... retail banking, as a core strategy to harness collaborative commerce, increase business geographic area, and sustain competitive advantage, have an opportunity to reformat the organizational...
Ngày tải lên: 01/06/2014, 13:57
c c lin, l a segel mathematics applied to deterministic problems in the natural sciences classics in applied mathematics 1988
Ngày tải lên: 12/06/2014, 16:10
báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx
... potentially useful tool to measure activities of daily life in patients with PAD Abbreviations ABI: Ankle/brachial index; ADL: Activities of daily life; ALDS: AMC Linear Disability Score; AMC: Academic ... critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional material 13 Additional ... extent to which respondents score at the bottom or top of a scale) it is very important to ask a patient activities he is able to and also activities he is not able to do, instead of asking too...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Hypothesis testing for evaluating a multimodal pattern recognition framework applied to speaker detection" doc
... speaker among two candidates in an audio-video sequence using simple material, namely, a single camera and microphone A mono audio signal contains no spatial information about the source location, ... classification This feature extraction step is followed by a classification step, where a label "speaker" or "non-speaker" is assigned to pairs of audio and video features Whereas we have already ... Tele-Health Solutions in the Ambient Assisted Living Lab In 21st International Conference on Advanced Information Networking and Applications Workshops (AINAW'07) Volume Niagara Falls, Canadax;...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx
... potentially useful tool to measure activities of daily life in patients with PAD Abbreviations ABI: Ankle/brachial index; ADL: Activities of daily life; ALDS: AMC Linear Disability Score; AMC: Academic ... critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional material 13 Additional ... extent to which respondents score at the bottom or top of a scale) it is very important to ask a patient activities he is able to and also activities he is not able to do, instead of asking too...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf
... 3B37 3A2 8 3B49 3B50 3A2 6 3B53 3A2 7 Controller 3A3 1 3A2 2 3A2 3 3A1 4 3A1 1 3A1 9 3B51 3B54 3A2 0 3A7 3B35 3B38 3A4 3A1 3A1 0 3A1 5 3A8 3A1 6 3B42 3B46 3A2 1 3A1 8 3A9 3A2 3A6 3A3 Figure 12: Spatial distribution ... have a simulator designed for WSN research It has advanced and accurate radio and wireless channel models Castalia is built on OMNeT++, a framework which provides the basic tools to write simulators ... the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) 5.2.1...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx
... 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of genomic sequences,” Computer Applications in the Biosciences, ... base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the energy of the input signal is decomposed ... For example, if S[n] = GGCATACACAGACACGCCGGCG, then S [n] = ATACACAGACAC, i = 4, p = 2, l = 12, α = AC, Λ ≡ {A, C}, and SA [n] is 2-periodic sequence (not necessarily exact) Ravi Gupta et al From...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot
... modifications had been made to the surface (a special type of paper was attached to the wall after preparation of the paintings) This a ected the transducer-wall coupling in such a way that different ... spatial resolution was too low We also tested a 10 MHz transducer, but attenuation was too high to allow reception of the interface echoes Finally, a MHz transducer was selected to give an adequate ... give an adequate balance between resolution and the capacity to penetrate into the mortar It should be noted that mortar is a material composed of sand and cement paste Two essential parts of its...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" pdf
... 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of genomic sequences,” Computer Applications in the Biosciences, ... base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the energy of the input signal is decomposed ... For example, if S[n] = GGCATACACAGACACGCCGGCG, then S [n] = ATACACAGACAC, i = 4, p = 2, l = 12, α = AC, Λ ≡ {A, C}, and SA [n] is 2-periodic sequence (not necessarily exact) Ravi Gupta et al From...
Ngày tải lên: 22/06/2014, 22:20
engineering a safer world systems thinking applied to safety
... Programmatic and Organizational Risk Analysis 231 8.6.2 Gap Analysis 232 8.6.3 Hazard Analysis to Identify Organizational and Programmatic Risks 235 8.6.4 Use of the Analysis and Potential Extensions ... Chapter had used to save their passengers and aircraft FAA investigators, the National Transportation Safety Board, and engineers at a subcontractor to McDonnell Douglas that designed the fuselage ... Morale at the plant was low “There was widespread belief among employees that the management had taken drastic and imprudent measures to cut costs and that attention to details that ensure safe...
Ngày tải lên: 27/07/2014, 23:23
Báo cáo lâm nghiệp: "Energy consumption of a chipper coupled to a universal wheel skidder in the process of chipping wood" pptx
... (independent variables) There was an assumption that the particular parameters influenced each other For the test generalization Duncan’s test was used For each variation of three-factor levels (4 assortments ... the fact that the factor does not have a statistical influence A reciprocal statistical dependence was found out between the maximum power (dependent variable) and wood, assortment and knife angle ... horizontal hydraulic cylinders which are secured by a hydraulic security system against impacts The maximum diameter of disintegrated material is 200 mm The other basic characteristics of this material...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo khoa học: "FIBRE : a French PC-based regional forest sector model applied to Burgundy" docx
... supply from an allowable cut, and distributing the actual cut among the diameter classes according to silvicultural coefficients The allowable cut is calculated as a share of Data Data requirements ... ―――――――――――――― Economic data costs and values are expressed in real terms with 1985 as a base year in order to eliminate inflation ... main problems must be solved when looking for and using data : (1) availability; and (2) consistency Ileac Availability It is often difficult to collect data at a regional level than at a national...
Ngày tải lên: 09/08/2014, 02:21