don t comment just for the sake of commenting
Quality and Power in the Supply Chain: What Industry Does for the Sake of Quality pdf
Ngày tải lên :
17/03/2014, 20:21
... in their attempt to satisfy yet another customer requirement, send their staff searching for the latest "quick fix." Quality and Power in the Supply Chain attempts to bridge the gap between the ... book The broad nature of the subject matter offered me little alternative but to gather the varied subjects into six interrelated parts Part I, Prologue, consists of Chapters and In it, the general ... of the ISO 9000 series of standards.) Naturally, third-party registrars were quite excited at the prospect of having to register the thousands of suppliers to the automotive industry Within the...
- 235
- 1.9K
- 0
Quality and Power in the Supply Chain: What Industry Does for the Sake of Quality pot
Ngày tải lên :
28/06/2014, 21:20
... in their attempt to satisfy yet another customer requirement, send their staff searching for the latest "quick fix." Quality and Power in the Supply Chain attempts to bridge the gap between the ... book The broad nature of the subject matter offered me little alternative but to gather the varied subjects into six interrelated parts Part I, Prologue, consists of Chapters and In it, the general ... of the ISO 9000 series of standards.) Naturally, third-party registrars were quite excited at the prospect of having to register the thousands of suppliers to the automotive industry Within the...
- 235
- 637
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... not accurately reflect the status and behavior of their counterparts localized in the target organ In this latter regard, there is experimental evidence that the blood carries at least a fraction ... islet-specific T cells can enter the pancreas to contribute to diabetes [69] Additionally, the T cells found in the blood, whether it be in their repertoire, function and state of activation, ... cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66]...
- 12
- 573
- 0
An investigation into English clause patterns - advances employable for the teaching of speaking skills to Vietnamese Seamen = Nghiên cứu các mô hình câu đơn tr
Ngày tải lên :
28/03/2015, 09:21
... recapitulation It then raises the limitations of the study The chapter ends with some suggestions for the further research Recapitulation The study aims to investigate the implications for teaching ... co-referential with the subject (or object) 21 2.4.2 Semantic features: Attribute The role of subject complement is that of attribute of the subject, whether a current or existing attribute ( with ... objectives of the study It then continues with the research questions The next section is the scope and the methodology This chapter ends with the design and significance of the study Rationale...
- 50
- 958
- 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
Ngày tải lên :
25/10/2012, 10:45
... Results The characteristics of the VARA participants measured at the start of each treatment episode were evaluated Because the characteristics of VARA patients at the start of non-biologic DMARD treatment ... potentially problematic for the measurement of patient-reported outcomes in all RA studies that include patients with these conditions Restricting the population to individuals without these ... activity even though the patient did not meet the DAS28 criteria for low disease activity or improvement For the 23 treatment episodes where the effectiveness algorithm criteria were not satisfied...
- 29
- 581
- 0
Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"
Ngày tải lên :
25/10/2012, 11:40
... tail of the pancreas For tumors of SPT located in the neck and body of the pancreas, resection of the midportion of the pancreas and the mass with preserving the rim of the head and tail portion ... 311 Fig The CT scan indicated the typical internal or capsular calcification in the SPT Once the diagnosis of SPT is made, surgery is the first choice of treatment, since other adjuvant therapies, ... limits The median diameter of the lesions was 8.0 cm (range 4-20) Nine patients had their tumors within the head, in the body and in the tail of the pancreas Notably one patient was demonstrated...
- 5
- 640
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
Ngày tải lên :
26/10/2012, 09:32
... dorsal root rhizotomy We speculate that the direct visualization of the joint allows better de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and ... conventional facet joint therapies, out of the 114 lumbar facet patients, 72 patients underwent facet injections elsewhere as treatment prior to considering the endoscopic option The facet injections ... Without endplate receptors present within the joint, dorsal root axons should be incapable of re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the...
- 4
- 599
- 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
Ngày tải lên :
26/10/2012, 09:57
... acknowledges that there are no conflicts of interest or financial benefits with the results of the study All twelve patients (10 males, females) completed the surgery without complication Average ... Table Utilizing the Student’s t- Test, the data was separated into pre and post surgical scores Even though the sample size is small, the improvement is significant with a p value of 0.005 With all ... Oswestry, respectively One patient with moderate symptoms, two with severe symptoms, and two with crippling symptoms did not report significant improvement on VAS or Oswestry Of the twelve patients,...
- 3
- 506
- 0
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"
Ngày tải lên :
26/10/2012, 10:04
... inhibitory effect SGLT Translocation Activity In order to investigate whether the thioglycosides were translocated into the cells by the SGLT cotransport system, their effect on membrane potential was ... complications of glucose toxicity observed in diabetes The results of the present study suggest that some thioglycosides have a therapeutic potential for the control of blood glucose levels This ... administered orally [27] Therefore, the aim of the present study was to evaluate the inhibitory effect of some thioglycosides synthesized in our laboratory on human hSGLT1 and hSGLT2 –as a potential...
- 9
- 650
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
Ngày tải lên :
03/11/2012, 10:58
... findings from the study patients Angiography After the MCG test, coronary angiography was performed at the discretion of the attending physicians and following the standards of the institution Angiographers ... coordinates of the curve confirmed that a cut-off score of 4.0 provides the best combination of sensitivity and specificity for the prediction of relevant coronary stenosis from the MCG test that was ... in the overall statistical analysis because the assumptions about the distribution of the data (normal distribution) were not violated Figure ROC For The Entire Study Population Using A Cut-Off...
- 13
- 684
- 0
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
Ngày tải lên :
13/04/2013, 10:30
... Last but not least, I would like to thank all the faculty and friends at SOM and AIT for their help and boundless inspiration ii Abstract The objective of the study is to investigate the customer ... in the city The pattern found is that the target customers are quite sophisticated, they are value-oriented, they are young working people with above-average income The top three important store ... by the growing private sector, these store still keep the large piece of the distribution system and well located in the central areas of the cities Most retailing in urban centers is done through...
- 51
- 1K
- 3
SOME SOLUTIONS FOR THE DEVELOPMENT OF CONSUMER LENDING AT TECHCOMBANK HOANG QUOC VIET
Ngày tải lên :
25/07/2013, 11:20
... contribute the growth of the whole system So, what are the solutions that help THQV not only meet and expand the amount of customers both in quantity and quality but also further strengthen the ... safety is the top target that Techcombank set In 2012, they will make the efforts of outstanding loans as well as mobilization of capital growth and profit before tax of the average growth in ... credit quality Because the branch did not take its full advantage and strength to get the best result Thus, it is important to further study the issue and find out some useful solutions for the...
- 43
- 1.2K
- 14
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
Ngày tải lên :
05/09/2013, 08:40
... variety of mutagens that were not detected in the standard tester strains They are suitable for mutagenicity of aromatic hydrocarbons, allyl hydrocarbons and insecticides, but not suitable for that ... supported by the research project The research on the development of the total evaluation technique for the hazardous impacts by the chemical substances towards human and ecology (the project leader ... that of herbicides, fumigants, heavy metals, inorganic chemicals and natural toxins, etc These results may suggest that the utility and limitations of both the Ames test and 8-OHGua assay in detecting...
- 6
- 735
- 0
Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent
Ngày tải lên :
05/09/2013, 08:40
... is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment of sewage effluent compared to the other processes ... ozone with substances in the water can be divided into two distinct pathways (7) The first route is the direct attack of molecular ozone The second route is the indirect reaction of OH° formed by ... However, it should be noted that other parameters should also be considered in the treatment of sewage effluent water A relatively high water quality must be achieved with the end goal of reusing the...
- 13
- 606
- 1
Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge
Ngày tải lên :
05/09/2013, 09:08
... calculated every minute using the following formula: The relative A660 = A660 of flocculating test A660 of control test For the control, the polymer solution was replaced by distilled water To estimate ... NaOH-extracted polymer exhibited the greatest activity, and the washing-extracted polymer possessed the lowest Among the cations tested, calcium and magnesium ions showed the greatest benefit on activity ... isolation of bioflocculants Thus, NaOH extraction was the most effective method for the extraction of bioflocculants from activated sludge, followed by steaming extraction SDS and washing extraction...
- 11
- 695
- 1
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
Ngày tải lên :
05/09/2013, 09:08
... know the benefit of having the connection of their latrines to biogas plants At the installation, the community agreed to share the 20% of the installation cost and the 100% of cleaning cost of ... built next to the dwelling units The alternate pit latrine consisted of a platform with a squatting pan and water-seal structure, two separate adjacent pits and a cover slab The platform with the ... squatting pan was to be placed on the pit that was in current use When the first pit filled up, the squatting pan was to be moved on the top of the second pit It was expected that this alternating...
- 9
- 971
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
Ngày tải lên :
05/09/2013, 09:38
... bacteria were performed NIT3, CCTGTGCTCCATGCTCCG (Wagner et al., 1995), Ntspa662, GGAATTCCGCGCTCCTCT Ntspn692, TTCCCAATATCAACGCATTT, Ntspn994, CAAGGCGGTCCCAAGCAA, Ntcoc84, TCGCCAGCCACCTTTCCG, Ntcoc206, ... species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set ... CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection of Nitrospira species In addition, FISH analyses targeted at different nitrite...
- 8
- 572
- 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
Ngày tải lên :
05/09/2013, 09:38
... Effect of HRT of the regeneration tank Fig illustrates the effect of HRT of the regeneration tank on the CARS system performance The COD removal increased with an increase in HRT of the regeneration ... et al., 2004), the present study showed that the Freundlich isotherm equation (Fig 7) also matched the experimental results well The obtained values of the constant characteristics for the two ... reports the experimental results of the CARS process for the municipal wastewater treatment The technical feasibility of this process was demonstrated, and the process optimization was performed...
- 8
- 686
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
Ngày tải lên :
05/09/2013, 10:15
... the control strategy for the selection of well-settling sludge Then, we applied the strategy to the formation of aerobic granular sludge in a continuous experiment In addition, the effect of feeding ... washout and retention Dissolved oxygen concentration at the middle part of reactors (approximately 1.5 m from the bottom of reactors) was over mg/L through the entire experiment The initial concentration ... from the bottom of the reactor, while the wastewater was intermittently fed (sequencing batch mode) in Run Hydraulic retention time (HRT) in Run was initially set at d (surface loading rate: 1.2...
- 8
- 481
- 0