... looking, then, for the concept among the answer choices that most nearly opposes the concept of the stem word Eliminate and Create Context Don t forget your trustworthy testing friend, elimination To ... at the beginning of the second unit tells you that you need words that contrast with intelligence and reason The third unit confirms that the concepts in these contrasting words lead to understanding ... reason remains static (in the same state) The second unit, the one with two blanks, tells you that there is another way of understanding (conceiving) that does not involve reason The word but at...
Ngày tải lên: 18/06/2014, 17:20
... whether the poor outcome of ventilated cirrhotic patients is related to the severity of their underlying liver disease, or that of the acute illness that precipitated admission Their retrospective ... and on mechanical ventilation This control group mortality figure is surprisingly high in this cohort of patients, and one must consider the fact that the study was powered only to demonstrate ... bilirubin concentration alone predict prognosis adequately robustly in this setting to shed the Child-Pugh score? Competing interests The author(s) declare that they have no competing interests References...
Ngày tải lên: 12/08/2014, 20:20
levitt - take on the street; what wall street and corporate america don't want you to know (2002)
... vigilant of their own interests Investor protection is supposed to be the responsibility of three institutions: the SEC, the stock exchanges, and the courts Yet over the past several years, the ... alternative, except to suggest that the SEC convene a panel to study the matter Instead, the SIA continued its flat-out opposition But the trade group did point out a number of flaws in the proposal, ... prospectus: Maturity and duration management decisions are made in the context of an intermediate maturity orientation The maturity structure of the portfolio is adjusted in anticipation of cyclical...
Ngày tải lên: 01/11/2014, 16:21
Don't Bet On It
... the townhouse of Kathy Pendleton belonged to her That wasn 't too startling The fingerprints on the other glass belonged to none other than Senator Collins Perhaps the affair had not ended until ... wait for further statements and then left with no further comment Wasn 't there a blond named Marilyn in the 60's who had intended to just this same thing to a politician but her untimely death ... out a while ago but there were no ties after the wedding and certainly no affair that was made public Up until two days ago that was the extent of their relationship and then Pendleton unexpectedly...
Ngày tải lên: 06/11/2012, 17:32
Tài liệu Module 6: Manipulating XML Data on the Client Using DOM doc
... Data on the Client Using DOM The text property The following script accesses the root element, and then retrieves the text property of that node This property returns the entire text content of the ... Navigate to the XML data island and note the ID Locate the LABEL elements at the bottom of the page and note their IDs Point out that the BUTTON element has an on- click event procedure that reads ... “document”, the nodeTypeString of an element is “element”, and the nodeTypeString of an attribute is “attribute” ! text returns the textual content of the node and all its descendants ! xml returns the...
Ngày tải lên: 10/12/2013, 16:16
Tài liệu Put the Finishing touches On A Data Bound Form pdf
... is True, then the focus is moved to the txtCustomerID text box When the txtClosed button is clicked, the application then checks whether the btnSave command button has been enabled, meaning data ... data is being edited If so, then the user is asked whether he wants to save the current record If the user does, the system then saves the current information back to the server Comments The tasks ... lstCustomers If not, then the two buttons, btnEdit and btnDelete, are disabled If a customer hasn 't been selected, the two buttons are enabled, and the dsCustomerIndividual dataset control is...
Ngày tải lên: 26/01/2014, 11:20
Negotiating Trick: Don't Focus on Price
... discussed, the buyer said, "That's more than the software cost!" The problem was that the buyer saw the decision as connected to license fees, rather than productivity and utilization Do not succumb to ... Is that what you were expecting?" Understand the value of a 100% assured outcome Many times, you get the opportunity to acquire a new client because a competitor has failed This means that the ... a price in the past and failed to achieve the desired outcome This actually provides a context: the cost of failing You now need to determine how the customer would value having confidence in...
Ngày tải lên: 06/02/2014, 17:14
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... was confessedly due to the fact that the men rowed when they were not in a fit state of health; in others, to the rowers being by nature constitutionally delicate; and in others again, to their ... from them that among sailors the disorders of the chest occasion about 28 per cent, of the general death-rate ; while the Reports on the health of the army clearly testify that in spite of the ... much to loosen their hold upon the youth of Great Britain Viewing athletic contests then as national institutions, what is their influence upon health ? Are they calculated to improve the physique...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu The Compleat Strategyst - Being a Primer on the Theory of Games of Strategy pdf
... Corporation researchers publish with commercial presses These books are not available from RAND but can be requested directly from the publisher, except in cases where the rights have reverted to ... publisher, except in cases where the rights have reverted to RAND and we have republished a new edition ...
Ngày tải lên: 17/02/2014, 23:20
Tài liệu “Don’t spit in the well - you may need to drink from it!” -- Unknown, Russia. docx
... down the drains and into gutters, carrying pollutants with it For more information about water consumption, as well as some tips on how to conserve water, see the Water Consumption fact sheet Keep ... information about dangerous pollutants that are found in domestic products, see the Emerging Contaminants fact sheet What impact does industrial activity have on water pollution? Industrial pollution ... Pollution; http://www.epa.gov/glnpo/image/viz_iss2.html What impact does agriculture have on water pollution? The greatest agricultural contributions to water pollution are through nutrient and...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Parsing, Projecting & Prototypes: Repurposing Linguistic Data on the Web" doc
... according to the PCFGs extracted from the projected phrase structures (Figure 3) The user can then click on the Data link for any language in the list to retrieve the IGT instances in that language ... sufficient data exists Following is an example profile: either display the data (where sufficient citation information exists and where the data is relatively clean) or locate documents in which the data ... Search by Linguistic Constructions This type of query looks either at enriched data in the English translation, or at the projected structures in the Open Language Archives Community http://www.language-archives.org/tools/search/...
Ngày tải lên: 22/02/2014, 02:20
Normative data for healthy elderly on the phonemic verbal fluency task – FAS doc
... account the influence of the different demographic variables The goals of the present study are to provide normative data for the Brazilian population on the verbal fluency test – phonemic tasks ... if not in the dictionary also counted When the participant corrected their response, this was not considered an error The final score only included correct answers The following items were considered ... and consists of saying words beginning with the letters F, A and S, one at a time for one minute The FAS test is related to the frequency of words beginning with each letter in each language Considering...
Ngày tải lên: 05/03/2014, 21:20
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... Psy2, with the latter being longer in the 5¢-region The start codon is located in the second exon in both genes Intron and exon numeration was changed compared to the original annotation of the Psy1 ... GAAACGGCTACCACATCCAAG CCCCGTGTTAGGATTGGGT AAGGCAGCAGGCGCGCAAA TGACGTCTCAAATGGGACAAGT CCTCGATGAATCAAAAAAACGG TCATGGAATCAGTCCGGGAGGGAA AGGCAAGGCTGGAAGATATTTTT GAAACAGTGTCGGATAAAGCTGC ACGGGCGGCCATTTGATATGCTTG ... ACGGGCGGCCATTTGATATGCTTG GGCCATTGTTGAAAGAGAGG TCATGCTTTATCTTTGAAGAGAGG TCTCTACGTGTATCAAAGGTAGTAAGG TGGCATTTAGAAACTTCATTCA Psy1 Psy2 Psy1 Psy2 GenBank accession number Amplicon (bp) Use BH012957 61 RT-PCR...
Ngày tải lên: 07/03/2014, 05:20
The Effect of Aesthetic on the Usability of Data Visualization pdf
... immediately locate the correct answer felt encouraged to continue their task In contrast, BeamTrees, the visualization technique with the lowest aggregate aesthetic rank, averaged the highest rate ... hypothesis is that aesthetic will have an effect on extending the latency of task abandonment and duration of erroneous response time This is potentially important because these factors correlate ... formulated towards the design of an industrial product, this study shows similar correlations in the field of data visualization More specifically, the results illustrate that the most aesthetic data...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "Predicting Strong Associations on the Basis of Corpus Data" pdf
... association plus cue (as in filmacteur ‘film actor’) While it is not clear if it is the compounds themselves that motivate the association, or whether it is just the topical relation between their two ... syntactic roles, like subject of fly Third, wordbased models simply use as features the words that appear in the context of the target, without considering the syntactic relations between them ... the most frequent association to each cue, and only included the pair in the test set if the association occurred at least 1.5 times more often than the second most frequent one This resulted in...
Ngày tải lên: 08/03/2014, 21:20
More Better? The Impact of Postsecondary Education on the Economic and Social Well-Being of American Society ppt
... survey data for simply stating the facts Regardless, economists have a solid history of attempting to account for the contribution of education to economic growth, many of them assert that the contribution ... More Better? Educational Policy Institute Too Much Education? The literature discussed to this point addresses the investment in postsecondary education and the benefits of that investment In this ... on- the- job training Moderate-term on- the- job training Associate's degree Short-term on- the- job training Associate's degree Short-term on- the- job training Short-term on- the- job training Short-term on- the- job...
Ngày tải lên: 17/03/2014, 08:20
Báo cáo " On the detection of gross errors in digital terrain model source data " pdf
... simple interpolation by averaging the height of neighbor points, the practical results in the tests DL1, DL6, DT1, and DT5 show that the AVG interpolation is actually better than the IDW one. Our explanation ... a better result than the simple one. almost the same. ‐ If the data are undergoing multiple tests then in the second and subsequent tests only V condition on Vthreshold makes sense. In the above ... 5‐50m Data acquisition method Project area Height of surface / Std. deviation Number of data points Spatial distribution of data points Average distance between data points Number of data points with ...
Ngày tải lên: 22/03/2014, 12:20
What Changes Are Being Made to Social Assistance Benefits: A Community Perspective on the Impact of these Changes. pdf
... lose their benefits because they will not be able to afford the cost of testing and therefore they won t be able to provide information about the identity of the father Birth Verification: Not ... too expensive so I don t get the pass I only take a few trips a month but sometimes I don t have enough money to cover even that.” Without a bus pass people won t use the services they need This ... benefits John Coreno, Social Services Coordinator for the City of Peterborough, outlined the “Discretionary Benefit Report” that was presented by the City staff to the Joint Services Committee on...
Ngày tải lên: 24/03/2014, 00:20