... Over time, employees become familiar with the competencies required for their current job and for achieving promotions, and they can then take more responsibility for their own knowledge competencies ... Shea DAU’s Performance Learning Model (PLM) is at the core of its efforts It is no accident that the name of the model blends the words performance and learning DAU’s initiatives meet the learning ... emerging themes Management Science, 49 (4) , 571-582 Baldwin, T., & Danielson, C (2000) Building a learning strategy at the top: Interviews with ten of America’s CLOs Business Horizons, 43 (6) , 5- 14 Barley,...
Ngày tải lên: 24/10/2013, 08:20
... quantified using the following formula: 1000 · [D420 ) (1.75)] ⁄ (T · V · D600), where the attenuance at 42 0 nm (D420) is due to product formation, D600 is the cell density of the culture, T is the reaction ... identity with SeMV Percentage similarity with SeMV 100 32 .4 100 50 17.8 27.5 17.1 32 .6 9.1 11 11.5 12.3 15.1 19.9 19.3 9.8 4. 7 2.7 14. 7 17 .6 6.9 6. 1 Fig Prediction of the secondary structure of the ... was added, and the mixture was incubated at °C for h with intermittent mixing The mixture was subsequently centrifuged at 100 g for 60 s to pellet the bound protein with the resin The supernatant...
Ngày tải lên: 15/03/2014, 00:20
Learning the iOS 4 SDK for JavaScript Programmers pdf
... Files What the runMyCode: Method Does 26 26 29 29 31 34 v Building the User Interface Adding a Button to the View Connecting the Button Going for a Test Ride Congratulations 35 38 42 46 49 Structural ... quit the app on the simulator (by clicking the Home button at the bottom center), you will see an icon for the app on the iPhone home screen The icon is one of the image files that came with the ... Expressions for Text Search and Replace Dragging a View Around the Screen The Code Portion The Interface Builder Portion Recap 220 221 222 223 2 24 225 2 26 228 231 233 233 235 2 36 2 36 238 239 240 241 241 ...
Ngày tải lên: 29/03/2014, 06:20
Apress beginning iOS 5 games development, using the iOS 5 SDK for ipad iphone and ipod touch (2011)
... from the library item A onto each of the views We gave the UIButton on the left the label Play, and the UIButton on the right the label Back To make the Play button navigate to the view on the ... Beginning iOS Games Development Using the iOS SDK for iPad, iPhone, and iPod Touch ■■■ Lucas Jordan i Beginning iOS Games Development: Using the iOS SDK for iPad, iPhone, and iPod Touch ... in portrait view on the iPhone and landscape view on the iPad In Figure 2, we see a simple Rock, Paper, Scissors game being run on both the iPad and the iPhone On the iPhone, the application is...
Ngày tải lên: 24/04/2014, 10:13
Báo cáo hóa học: " Tula hantavirus isolate with the full-length ORF for nonstructural protein NSs survives for more consequent passages in interferon-competent cells than the isolate having truncated NSs ORF" pptx
... TGTTCCAATCATACAGACCTTC 783–8 04 10 26 1 048 4 26 44 4 933–953 5 54 5 76 792–8 14 895–918 1128–1 149 83–1 06 795–817 44 4– 46 6 558–579 Amplicon size (bp) 266 528 261 255 735 1 36 Page of (page number not for citation purposes) ... (Lodz, S, forw) LVSR10 26 (Lodz, S, rev) LodzG2F4 26 (Lodz, M, for) LodzG2R953 (Lodz, M, rev) LodzG2F5 54 (Lodz, M, nested PCR, forw) LodzG2R8 14 (Lodz, M, nested PCR, rev) TulSF895 (Moravia, S, forw) ... E6infected with the supernaDetection of TULV in MRC5 cells infected with the supernatant from double-infected Vero E6 cells MRC5 cells were infected with the passage supernatant from Vero E6...
Ngày tải lên: 20/06/2014, 01:20
effectiveness of teaching grammar with the use of dictogloss for students of k37a maths class, at hanoi college of education = hiệu quả dạy ngữ pháp bằng phương pháp dictogloss cho sinh viên lớp sư phạm
... from the interview for teachers 58 3.2.2 Data from the Post-test 60 3.2.3 Data from the post-questionnaire 65 3.2 .4 Data from the post-interview for students 69 ... acquisition” and “allows the teacher to deal with language points as they come up, rather than having to anticipate them and prepare for them in advance.” Unfortunately, from the negative angle, according ... students come up with the task of analysis and correction With the help from their teacher, learners are required to analyze the similarities and differences with the original version, and then correct...
Ngày tải lên: 02/03/2015, 14:30
Challenges in teaching and learning speaking skill with the new English textbook for grade 10 (Basic Stream) at Xuan Hoa High school, Vinh Phuc province and some solutions
... textbooks, the teachers have been prepared for the new methods of teaching and learning Therefore, they have thorough understanding about the nature of the new textbooks However, both the teachers ... challenges in the process of working with the new English textbooks It seems that they not fulfill the requirements of the new textbooks at all Of the four language skills, speaking is becoming the primary ... towards speaking skill and then put the focus on the current difficulties in the application of the new textbook The causes of their difficulties are also examined so that the solutions to those...
Ngày tải lên: 10/08/2015, 19:51
iOS Forensic Analysis: for iPhone, iPad, and iPod touch doc
... directly with the iPhone Still, Apple has still stayed above the rest with the ability to support not only the hardware but also the operating system The 3G iPhone The second generation of iPhones ... functions The 3G[S] iPhone In June 2009, Apple released its newest iPhone, the iPhone 3G[S], shown in Figure 1 6 Figure 1 6 The Apple iPhone 3G[S] (courtesy of Apple) The 3G[S] was also the released with ... as portable It has the same processor as the iPhone and comes in 16GB, 32GB, and 64 GB variations Under the Surface: iPhone and iPad Hardware How the interface functions in the iPhone 2G, 3G, and...
Ngày tải lên: 06/03/2014, 07:20
Learn gamesalad for ios: Game Development for iPhone, iPad, and HTML5 potx
... registered Apple developer page For the purpose of this book, I will show you the steps for the creation of a new Apple ID for the enrollment into the iOS Developer Program The next step is to choose ... 2-5 The GameSalad launch screen www.it-ebooks.info 35 36 CHAPTER 2: The Pong Game You will arrive to the page shown in Figure 2 -6 Figure 2 -6 The Project Info page This page is the project information ... information about the project, such as the title of the project, the game’s platform, a description, and instructions Enter the information shown in Table 2-1 www.it-ebooks.info CHAPTER 2: The...
Ngày tải lên: 14/03/2014, 10:20
Pro iOS Table Views: for iPhone, iPad, and iPod touch (1st Edition) pdf
... The app delegate The view controller The view, which has the table view embedded within it Figure 1–17 shows how the three objects relate, together with their outlets www.it-ebooks.info 23 24 ... h and m files with the Ctrl + Command + Up Arrow key combination, or by clicking the filename in the breadcrumb display at the top of the code editor then selecting the file from the drop-down ... “How The Table Fits Together,” you’ll look at how the parts of the table view work together You’ll see the main types of UITableViews and their anatomy You’ll learn how to create them both with...
Ngày tải lên: 23/03/2014, 04:20
Tài liệu Embedding Perl in HTML with Mason Chapter 6: The Lexer, Compiler, Resolver, and Interpreter Objects doc
... instances of another class, as the Interpreter does with Request objects, it will accept the created class's parameters in the same way, passing them to the created class at the appropriate time ... contains another object, the containing object will accept constructor parameters intended for the contained object For example, the Interpreter object will accept parameters intended for the Compiler ... outside the other two types of sections) The Perl and text sections can become part of the component's final output, whereas the Mason directives control how the output is created Similar to the...
Ngày tải lên: 14/12/2013, 12:15
Tài liệu More iOS 6 Development: Further Explorations of the iOS SDK doc
... programs that won’t run in the simulator The other two options are to sign up for an iOS Developer Program, either the Standard (commercial) Program or the Enterprise Program The Standard Program costs ... depended on another component, you’d see the hierarchical relationship between the two with the hierarchical outline style The bulk of the Editor pane is taken up by the Detail editor The Detail ... the template app The major differences lie in the entity at the heart of the application and in the addition of a tab bar at the bottom of the screen Let’s get to work 39 www.it-ebooks.info 40 ...
Ngày tải lên: 20/02/2014, 02:20
Build An Iphone App in 5 Days with iOS 6 SDK potx
... resulting in the dimensions of an iPhone or iPhone 4s retina display being a total of 64 0 960 pixels (see Figure 1-3) The iPhone screen packs in 64 011 36 pixels (see Figure 1-3) The status bar ... and e-mail them to my designer with detailed instructions to mock up the final designs in Photoshop The designer then creates 64 0 960 pixel retina-ready PSD files for each view of the app 10 ... or other suffixes to get (roughly) the App Store title they want Don’t confuse your App Store title with the bundle display name, which is the title of your app on the iPhone home screen They...
Ngày tải lên: 06/03/2014, 03:20
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... thr::Tn10 MC4100DtatA/E MC4100DtatADtatE MC4100DtatB MC4100DtatB MC4100DtatC MC4100DtatC::XSpecr HDB37 MC4100araD pC4Meth-100TorA/ pC4Meth, 94torA/ P2TAG13 P2TAG13 pC4Meth-100TorA/ pC4Meth, 94torA/ ... P2TAG 24 P2TAG 24 pC4Meth-57SufITAG8 pC4Meth, 51sufITAG8 pC4Meth-93SufITAG8 pC4Meth, 87sufITAG8 pC4Meth-SufIHATAG8 pC4Meth, sufIHATAG8 pBAD18-SufIHA pBAD18, sufIHA pJH42 pBAD18, tig Reference [40 ] ... (2003) DmsD is required for the biogenesis of DMSO reductase in Escherichia coli but not for the interaction of the DmsA signal peptide with the Tat apparatus FEBS Lett 5 34, 1 56 160 Miller, J.H (1992)...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx
... )| , n log provided that the limit exists Otherwise, by taking the upper and lower limits respectively we get the formulas for α(s) and α(s) We first prove: 2 .4 Lemma For any two consecutive points ... Lagarias and Y Wang, Tiling the line with translates of one tile, Inventions Math 1 24( 19 96) , 341 - 365 S M Ngai and Y Wang, Hausdorff dimention of the self - similar sets with overlaps,J London Math ... consecutive points Therefore # sk+1 # sk = k < k + # sk+1 # sk (6) 3k+1 < Proof of Proposition 2.3 We first show that for rgiven ≥ and for any s ∈ supp µ log µ(Br3−n (s)) if there exists lim , then log(r3−n...
Ngày tải lên: 14/03/2014, 13:20
Beginning iOS 6 Development: Exploring the iOS SDK doc
... work with than on modern computers The screen is just 320 × 48 0 on the first few iPhone generations, and was later doubled in both directions to 64 0 × 960 with the introduction of the iPhone 4 s ... CHAPTER 1: Welcome to the Jungle SDK VERSIONS AND SOURCE CODE FOR THE EXAMPLES As the versions of the SDK and Xcode evolve, the mechanism for downloading them will also change Starting with the release ... came out in 2007 The rise of the mobile software platform means that people are using software everywhere they go With the release of iOS 6, and the latest incarnation of the iOS software development...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... 98 1 24 100 2 .6 59,023 38 4 46 99.8 0. 063 (0. 149 )b 17 .4 (12.9)b C2 28 140 99.9 0. 0 64 (0.195)b 9.7 (3 .6) b P21 19,275 96. 8 0.078 (0.122)b 7 .4 (5 .4) b C2 121.5 50 .4 107.8 1 04. 3 47 .5 92.3 55.9 91 .4 120.9 ... 0.0 06 1.3 5038 125 45 2 5038 78 383 5038 225 47 4 11.9 42 .3 21.5 16. 4 37.7 25 .6 13.9 54. 5 19 .4 ˚ ˚ The values for the highest resolution shell are given in parentheses (2.21–2.08 A for D356N/P2, ... (A2) 46 2.08 38 345 99.7 (99.2)a 0.1 54 (0.155)a 0.187 (0.211)a 0.005 1.3 33–2 .6 28 120 99.7 (99.5)a 0.1 56 (0.1 94) a 0.200 (0.2 54) a 0.0 06 1.3 35–2 .6 19,275 96. 7 ( 84. 1)a 0.150 (0.183)a 0.190 (0. 2 64 )a...
Ngày tải lên: 16/03/2014, 14:20
More iOS 6 Development: Further Explorations of the iOS SDK docx
... programs that won’t run in the simulator The other two options are to sign up for an iOS Developer Program, either the Standard (commercial) Program or the Enterprise Program The Standard Program costs ... depended on another component, you’d see the hierarchical relationship between the two with the hierarchical outline style The bulk of the Editor pane is taken up by the Detail editor The Detail ... the template app The major differences lie in the entity at the heart of the application and in the addition of a tab bar at the bottom of the screen Let’s get to work 39 www.it-ebooks.info 40 ...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc
... 2 04 300 322 347 366 4 46 370 544 560 525 61 5 550 66 8 67 2 778 68 7 713 872 8 34 968 993 850 8 74 1133 11 86 9 96 1011 10 36 12 96 1077 1173 1198 1239 1335 13 76 41 8 42 5 49 9 5 06 570 578 587 60 7 66 8 68 8 760 ... F2–2a F3-1 F4-1 F4-2 F4-3 F4 -4 F5-1 F5-2 F5–2b Linkage 2,3 ,4- FucOH 2,3 ,4 ,6- ManOH 3 ,4 ,6- ManOH 2,3 ,4- ManOH 2 ,4 ,6- ManOH 3 ,4- ManOH 2 ,4- ManOH 2,3 ,4 ,6- GalOH 3 ,4, 6GlcN(Me)AcOH 3 ,6- GlcN(Me)AcOH 4 ,6- GlcN(Me)AcOH ... F4-1 F4-2 F4-3 F4 -4 F5-1 F5-2 947 .9b 1132.8 1295.1 13 36. 3 145 7 .4 149 8.5 1539.8 850.0 1012.2 149 8.3 995.5 1011 .6 1157.9 11 74. 2 1157.7 1319.8 948 .4 1133.0 1295.2 13 36. 3 145 7.3 149 8 .4 1539 .4 849 .8...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo hóa học: " Research Article Step Size Bound of the Sequential Partial Update LMS Algorithm with Periodic Input Signals" potx
... support for subsequent parts The second part of the section revises the analysis performed by Widrow and Stearns of the effect of the gradient noise on the LMS algorithm [ 16, Chapter 6] The section ... to the covariance of the noise as follows [ 16, Chapter 6] : μ μ Λ Λ2 The weights of the adaptive filter when the Gμ -FxSLMS algorithm is used are updated according to the recursion (41 ) In (41 ), ... wL Updated during the 2nd iteration with x¼ (n L + N), during the (N + 2)th iteration with x¼ (n L + 2N), Updated during the Nth iteration with x¼ (n N), during the 2Nth iteration with...
Ngày tải lên: 22/06/2014, 22:20