does it make a difference

... Cell Transplantation Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Chapter The Advanced HLA Typing Strategies for Hematopoietic Stem Cell Transplantation ... consequently a more accurate assessment of transplant-related complications Author details Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Immunogenetics Laboratory, ... Stefoni, Jeane Eliete Laguila Visentainer, Amanda Marangon, Daniela Cardozo, Ana Maria Sell, Miroslaw Markiewicz, Wanming Da, Toshihisa Tsuruta, Xiang Gu, Gülsan Sucak, Zeynep Arzu Yegin, Şahika Zeynep...

Ngày tải lên: 18/02/2014, 04:20

... mouse and human embryonic stem cells J Anat 200, 233-242 Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S (2008) ... Copycat) and monkey In 2006, reprogrammed murine iPSCs were reported by Takahashi and Yamanaka (Takahashi and Yamanaka, 2006) and in 2007 human iPSCs were reported (Takahashi et al., 2007; Yu et al., ... The accuracy of testing and matching criteria has an important impact on the transplant outcome, but exact matching across multiple HLA loci (e.g., HLA -A, HLA-B, HLA-C, and HLA-DRB1) is a challenging...

Ngày tải lên: 20/02/2014, 08:20

... GGTCTTGGTCAGCTCTGTGAGTC TRPC3 GACATATTCAAGTTCATGGTCCTC ACATCACTGTCATCCTCAATTTC TRPC4 GCTTTGTTCGTGCAAATTTCC CTGCAAATATCTCTGGGAAGA TRPC5 CAGCATTGCGTTCTGTGAAAC CAGAGCTATCGATGAGCCTAAC TRPC6 GACATCTTCAAGTTCATGGTCATA ... GCTACGAGCTGCCTGACGG GAPDH TATCGTGGAAGGACTCATGACC TACATGGCAACTGTGAGGGG TSP1 CCGGCGTGAAGTGTACTAGCTA TGCACTTGGCGTTCTTGT TRPC1 GATTTTGGAAAATTTCTTGGGATGT TTTGTCTTCATGATTTGCTATCA TRPC2 CATCATCAT-GGTCATTGTGCTGC ... GACATCTTCAAGTTCATGGTCATA ATCAGCGTCATCCTCAATTTC TRPC7 CAGAAGATCGAGGACATCAGC GTGCCGGGCATTCACGTGGTA Actin Annealing Cycle T (°C) number acquired with a Hamamatsu (Bridgewater, NJ) camera (10 s intervals,...

Ngày tải lên: 07/03/2014, 05:20

... NADH as well as cell viability Talanta 44, 1299–1305 Ishiyama M, Tominaga H, Shiga M, Sasamoto K, Ohkura Y & Ueno K (1996) A combined assay of cell viability and in vitro cytotoxicity with a ... test Data with a P-value of less than 0.05 were considered to be significant Acknowledgements We thank Mr Takafumi Yamaguchi, Mr Taisei Ishioka, Mr Masakazu Yoshizumi and Mrs Hitoe Takahashi FEBS ... applicable as an anti-inflammatory drug for the treatment of various inflammatory diseases [24–28] It is possible that other organic selenium compounds may also become candidates as anti-inflammatory ⁄ antioxidative...

Ngày tải lên: 23/03/2014, 07:20

... modulating AMPK in two melanoma cell lines, one with a BRAF mutation and another with an NRAS mutation [14] This study suggested that AMPK may have a role as a negative regulator and suppressor of malignant ... kinase, fatty acid oxidation, and glucose uptake in rat muscle Am J Physiol 1997, 273:E1107-1112 Woodard J, Platanias LC: AMP-activated kinase (AMPK)-generated signals in malignant melanoma cell ... drives resistance to RAF inhibition through MAP kinase pathway reactivation Nature 2010, 16;468(7326):968-72 Villanueva J, Vultur A, Lee JT, Somasundaram R, Fukunaga-Kalabis M, Cipolla AK, Wubbenhorst...

Ngày tải lên: 18/06/2014, 19:20

... Signaling via PLCγ2 pathway 1.3.3 Signaling via Ras/Raf/Erk pathway 1.3.4 Signaling via Vav/Rac pathway Src family kinases Adaptor proteins in lymphocyte signaling 1.5.1 Bam32 1.5.2 TAPP & Negative ... (Allam and Marshall, 2005) Instead of a SH2 domain as in Bam32, TAPP1 and TAPP2 have a second PH domain at the N-terminal and three residues - Ser-Asp-Val at their extreme Cterminal which match ... cytoplasmic protein tyrosine kinase and a key negative regulator of SFKs (Nada et al., 1991) It consists of a SH3 domain at its N-terminal followed by a SH2 domain and a catalytic kinase domain at...

Ngày tải lên: 12/09/2015, 08:16

... Yoshida, K., Yamashita, Y., Miyazato, A. , Ohya, K., Kitanaka, A. , Ikeda, U., Shimada, K., Yamanaka, T., Ozawa, K., and Mano, H (2000) J Biol Chem 275, 24945–24952 24 Lemay, S., Davidson, D., Latour, ... times with 1% BSA in PBS and incubated at room temperature for h with Alexa 546-conjugated goat anti-mouse or Alexa 488-conjugated chicken anti-rabbit antibody to reveal the respective primary antibodies ... Sunnyvale, CA) Luciferase activity was calculated as increments (n-fold) in IgG F(abЈ)2 fragment-induced activity over basal activity obtained with unstimulated cells Inhibitory Role of Leupaxin...

Ngày tải lên: 12/09/2015, 08:16

... kinase and Ras/Raf/ERK pathway, and some of these pathways are known to engage in crosstalk with each other (Okita and Yamanaka, 2006) The signaling pathways and potential crosstalk between them are ... LIF/JAK/STAT pathway (Adopted from Okita and Yamanaka, 2006) 24 Chapter I Introduction 1.3.2 Expression pattern of stat3 Stat3 was initially identified as the acute-phase response factor (APRF), activated ... the activation of intracellular signaling pathways such as the mitogenactivated protein kinase (MAPK) or the phosphatidylinositol-3 phosphate (PI3K) pathways (Qu, 2002; Okita and Yamanaka, 2006)...

Ngày tải lên: 14/09/2015, 13:38

... Experimental help and data analysis AV: Data analysis and manuscript writing PD.: Experimental help and manuscript writing SKB: Conception and design, financial support, data analysis and interpretation, ... and CA133774) and the Susan G Komen Foundation (KG070826) The authors acknowledge the invaluable technical support from Mr Erik Moore and Mrs Kavita Mallya We also thank Janice A Tayor and Page ... incubated with the anti-MUC4 mouse monoclonal and anti-HER2 rabbit polyclonal antibodies, washed, and followed by secondary incubation with FITC-conjugated goat anti-mouse IgG and anti rabbit PI...

Ngày tải lên: 20/06/2014, 07:20

... cross-sectional and longitudinal analysis as appropriate Prior research suggests that the conditioning regimen [22], age at transplantation [27], indication for transplant (non-malignant hematological ... measure of cancer related fatigue [73] The FACIT-Spiritual is a 12-item measure of spiritual well-being in patients with a chronic illness, including cancer [73,80] The FACIT-Fatigue and the FACIT-Spiritual ... particular areas (e.g fatigue management, sleep quality, psychological adjustment) offered the primary care team referral suggestions, when appropriate Measurement Physical and Mental Health is measured...

Ngày tải lên: 20/06/2014, 15:20

... The microarray data sets of various normal tissues and ESCs were retrieved from public databases The ESCs used for microarray analysis were H9 clones and all microarray data are available at GEO ... Veterans General Hospital, Taipei, Taiwan Graduate Institute of Dental Sciences and Department of Periodontology, National Taiwan University, Taipei, Taiwan 3Graduate Institute of Medical Engineering ... Abraham S, Colman A, Sartipy P, Matsui S, Carpenter M, Gazdar AF, Rao M, Chakravarti A: Genomic alterations in cultured human embryonic stem cells Nature genetics 2005, 37:1099-1103 43 Takahashi...

Ngày tải lên: 10/08/2014, 05:21

... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and ... Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell transplantation: incidence and clinical significance...

Ngày tải lên: 12/08/2014, 04:21

... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and ... Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell transplantation: incidence and clinical significance...

Ngày tải lên: 12/08/2014, 04:22

... antibody arrays 196 xviii List of Abbreviations AIF ALP ALT AP-1 APAP APR AST ATP TTP BSA BTI CAT Apoptosis-inducing factor Alkaline phosphatase Alanine aminotransferase Activating protein-1 Acetaminophen ... Cytochrome c Apaf-1 Procaspase Caspase Caspase Procaspase Caspase Apoptosis Figure Death-receptor-mediated and mitochondrial pathways of cell apoptosis 15 1.3.3 Conclusion Although each drug may cause ... (Stat3) transcription factor through JAK/STAT signal transduction pathway [74, 75] In addition to that, mitogen activated protein kinase (MAPK) signal transduction pathway can be activated by either...

Ngày tải lên: 09/09/2015, 11:21

... inducible, macrophage nasal polyp outer dynein arms oral-facial-digital syndrome oral-facial-digital syndrome pathogen associated molecular patterns primary ciliary dyskinesia pericentriolar material ... pathogenesis and molecular mechanisms leading to aberrant epithelial remodeling and impairment of mucociliary apparatuses such as cilia architecture and ciliogenesis in hyperplastic nasal epithelium ... indicated that nasal basal cells play as multi-potential stem cells in nasal epithelium However, the biophysiological mechanism under proliferation and differentiation of basal cells in nasal cavity...

Ngày tải lên: 09/09/2015, 11:29

... R: ggagccgtagtgagcagttc atgcctcacacggagactgt aagtgggttgtttgcctttg ggcacagttagagccaactaaga ccgagcagcactaacacg gagaggcagctgagatcagaa tgagaatacgatgtctgcaggt gtggagagcaactccgatg tctgcagagctttgatgtcc ... ggcacacacacattaacacactt ggtgtgtgagagcaattctcag aggtggttgaccttcaatgg tttgatttcttccagcattgtg gagtctgcctgttgcagga cagcgtctgacagcgaca aagttcaacaacaactgctaccaa gaagctcgtcatgcagttca ttgctgcctctttaagactagga ... agaaggagctgcgacaattc tccaaagtaggtgaccaagtcc gaccccaaggattacctcatt gttgatggcctccagtgac gcacacgttattcggatcg gcttgtcctccttctcgttc aactacgcgtttctccatgc aaagtgggcctttctccatc agccacatcgctcagacac gcccaatacgaccaaatcc...

Ngày tải lên: 09/09/2015, 17:54