discovery and development of pl 100 a novel hiv 1 protease inhibitor

Organization and Development of Russian Business A Firm-Level Analysis_1 potx

Organization and Development of Russian Business A Firm-Level Analysis_1 potx

... 6,960 1, 317 1, 875 10 ,15 2 19 95 1, 134 298 10 4 1, 536 19 99 1, 830 274 17 0 2,274 2000 1, 777 498 1, 479 17 ,538 12 ,2 91 41, 609 1, 544 3 21 264 2 ,12 9 19 98 2,245 226 86 2,557 2002 12 1 15 2 16 1 434 2003 13 5 246 12 1 ... procurement plans Physical demand was also a matter of certain importance This demand was taken into account in the compilation of a plan for the next term, but the compilation was also affected by many ... increases the chances to obtain financial and organizational support from the state and, thus, is a rational strategy of market players In Chapter 12 , we analyze the influence of the state on...

Ngày tải lên: 20/06/2014, 23:20

23 335 0
Organization and Development of Russian Business A Firm-Level Analysis_2 pdf

Organization and Development of Russian Business A Firm-Level Analysis_2 pdf

... Black, B., Kraakman, R., & Tarassova, A (2000) Russian privatization and corporate governance: What went wrong? Stanford Law Review, 52: 17 31 18 08 978023_0 217 287_03_cha 01 dd 33 5 /12 /2009 5 :19 :16 ... average-concentration companies Studies dating back primarily to the late 19 90s (for example, Dolgopyatova 20 01) found that a higher concentration of capital was characteristic of smaller companies and businesses ... reduced to a growth of holdings of company managers, with a noticeable decrease of holdings of all employees and a higher participation of external owners, primarily Russian legal entities, against...

Ngày tải lên: 20/06/2014, 23:20

23 267 0
Organization and Development of Russian Business A Firm-Level Analysis_3 docx

Organization and Development of Russian Business A Firm-Level Analysis_3 docx

... shares of managers and rank -and- file employees declined, and those of representatives of large external shareholders grew At companies with low and average levels of concentration, the management, ... opportunistic behaviors of company managers and disciplining them toward the maximization of shareholder equity under the separation of ownership and management (Fama & Jensen 19 8 3a, 19 83b) This can also ... comparative advantage 31. 2 Share (%) 235 No of affirmative respondents All companies Comparative advantages of open and closed companies over an alternative corporate form of joint-stock company (a) ...

Ngày tải lên: 20/06/2014, 23:20

23 262 0
Organization and Development of Russian Business A Firm-Level Analysis_4 pptx

Organization and Development of Russian Business A Firm-Level Analysis_4 pptx

... 5 /14 /2009 3:46:33 PM 17 16 5 37 94 12 98 879 1, 280 11 3 530 2 51 199 13 5 14 7 63 10 5 2005 19 90–20 01 1996 19 96 19 98 19 90–99 19 89 19 95 19 91 95 730 19 96 20 01 1996 19 96 19 96 19 96–98 19 92–94 13 .97 10 .13 ... 5. 01 2.74 1. 87 S D 8 12 13 16 11 12 12 16 11 12 11 Median Board size (no of directors) Table 4.2 International comparison of board size and proportion of outsider directors 42.7 39 48 53 .1 81 ... 19 99 19 99 19 90–2003 19 96 2000 Analysis period 19 93–96 19 94 19 96 19 93–99 19 96 19 96 19 96 19 96 8. 01 8.07 12 .03 5.30 12 .93 15 .06 9.23 12 .29 6.07 6. 21 11. 88 11 .79 16 .37 11 .46 12 .34 10 . 81 Mean 2.32 2.64...

Ngày tải lên: 20/06/2014, 23:20

23 326 0
Organization and Development of Russian Business A Firm-Level Analysis_6 pdf

Organization and Development of Russian Business A Firm-Level Analysis_6 pdf

... option plan in which management and employees were allowed to acquire a maximum of 51% of a firm’s total stock at 70% of face value As a result, the vast majority of the privatized firms were heavily ... 5 .1 Studies of managerial turnover in Russian firms Paper Barberis et al (19 96) Frydman et al (19 96) Klepach et al (19 96) Linz (19 96) Filatotchev et al (19 9 9a) Filatotchev et al (19 99b) Basargin ... 33.3 71. 4 40.0 66.7 33.3 Not significant 10 0. 0 0.0 0.0 50.0 66.7 28.6 60.0 33.3 33.3 Significantly positive Composition (%) 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 Total Table 5.2...

Ngày tải lên: 20/06/2014, 23:20

23 213 0
Organization and Development of Russian Business A Firm-Level Analysis_7 pot

Organization and Development of Russian Business A Firm-Level Analysis_7 pot

... enterprise Large owner Hired manager Significance of differences 0.000 b Independent (autonomous) enterprise Status of the JSC general director % by line 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 Total 4 81 278 ... 2006, p 13 ) Information arrays, available for experts, are related to specific groups of companies, such as, for example, a study of Rachinsky (2002) based on a sampling of 11 0 large Russian enterprises, ... intensity of a company’s modernization and restructuring The main trends for the formation of a cohort of CEOs and managerial teams are discovered on the basis of a comparative analysis of independent...

Ngày tải lên: 20/06/2014, 23:20

23 304 0
Organization and Development of Russian Business A Firm-Level Analysis_10 docx

Organization and Development of Russian Business A Firm-Level Analysis_10 docx

... am grateful to Naohito Abe, Tatiana Dolgopyatova, Victoria Golikova, Satoshi Mizobata, Heiko Pleines, Fumikazu Sugiura, and Andrei Yakovlev as well as participants of the Joint Workshop of Japan ... indicator is the profitability (ratio of profit to sale) and returns on asset (ROA) indicators obtained on the basis of companies’ book reports from SKRIN and SPARK databases .10 The AVEPRO and ROAAVE ... indicators is justified by previous 9780230_ 217 287 _11 _cha09 dd 219 5 /14 /2009 11 :06 :15 AM 220 Organization and Development of Russian Business experience of an empirical analysis of Russian companies’...

Ngày tải lên: 20/06/2014, 23:20

23 286 0
Organization and Development of Russian Business A Firm-Level Analysis_11 pot

Organization and Development of Russian Business A Firm-Level Analysis_11 pot

... 1. 7 10 0. 0 10 0. 0 0.5 0.3 47.6 52 .1 3.9 7.7 0.8 1. 5 10 0. 0 10 0. 0 NA NA NA 14 .0 52.2 6 .1 0.5 10 0. 0 19 .0 55.9 5 .1 1.4 10 0. 0 14 .4 69.6 4.5 0.4 10 0. 0 Source: Compiled and calculated by the author based ... 29.5 11 .8 11 .3 14 .4 11 .5 7.8 9.8 8.6 7.8 8.6 10 .3 6 .1 6.6 24.0 24.0 29.3 13 .8 21. 7 26.2 10 .1 10.3 10 .5 9.6 9.5 9.5 4.6 11 .5 14 .4 8.9 11 .5 9.8 2.9 2.5 2.3 3.4 1. 1 6.6 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 ... 10 0. 0 10 0. 0 30.2 21. 9 19 .0 29.0 10 0. 0 24.2 20.2 20.7 34.9 10 0. 0 22 .1 23.4 15 .8 38.7 10 0. 0 25.3 12 .6 20.7 41. 4 10 0. 0 26.7 21. 7 23.3 28.3 10 0. 0 23.0 14 .8 13 .1 13 .1 10 0. 0 Total (b) Geographical location...

Ngày tải lên: 20/06/2014, 23:20

23 253 0
Organization and Development of Russian Business A Firm-Level Analysis_13 pptx

Organization and Development of Russian Business A Firm-Level Analysis_13 pptx

... place after a period of chaos and uncertainty in the 19 90s allows us to draw a parallel between Russia and the China of the 19 80s rather than contemporary China It is noteworthy that empirical ... Journal of the Latin American and Caribbean Economic Association, 3: 16 1– 218 Megginson, W L., Nash, R C., & Van Randenborgh, M (19 94) The financial and operating performance of newly privatized ... the negative in the nearest future Acknowledgments I would like to thank my colleagues Tatiana Dolgopyatova, Larisa Gorbatova, Ichiro Iwasaki and Anna Lukyanova, as well as Lev Freinkman, Daniel...

Ngày tải lên: 20/06/2014, 23:20

23 195 0
Organization and Development of Russian Business A Firm Level Analysis_1 pptx

Organization and Development of Russian Business A Firm Level Analysis_1 pptx

... 5 /14 /2009 3:46:33 PM 17 16 5 37 94 12 98 879 1, 280 11 3 530 2 51 199 13 5 14 7 63 10 5 2005 19 90–20 01 1996 19 96 19 98 19 90–99 19 89 19 95 19 91 95 730 19 96 20 01 1996 19 96 19 96 19 96–98 19 92–94 13 .97 10 .13 ... 5. 01 2.74 1. 87 S D 8 12 13 16 11 12 12 16 11 12 11 Median Board size (no of directors) Table 4.2 International comparison of board size and proportion of outsider directors 42.7 39 48 53 .1 81 ... 19 99 19 99 19 90–2003 19 96 2000 Analysis period 19 93–96 19 94 19 96 19 93–99 19 96 19 96 19 96 19 96 8. 01 8.07 12 .03 5.30 12 .93 15 .06 9.23 12 .29 6.07 6. 21 11. 88 11 .79 16 .37 11 .46 12 .34 10 . 81 Mean 2.32 2.64...

Ngày tải lên: 21/06/2014, 12:20

23 196 0
Organization and Development of Russian Business A Firm Level Analysis_3 pdf

Organization and Development of Russian Business A Firm Level Analysis_3 pdf

... option plan in which management and employees were allowed to acquire a maximum of 51% of a firm’s total stock at 70% of face value As a result, the vast majority of the privatized firms were heavily ... 5 .1 Studies of managerial turnover in Russian firms Paper Barberis et al (19 96) Frydman et al (19 96) Klepach et al (19 96) Linz (19 96) Filatotchev et al (19 9 9a) Filatotchev et al (19 99b) Basargin ... 33.3 71. 4 40.0 66.7 33.3 Not significant 10 0. 0 0.0 0.0 50.0 66.7 28.6 60.0 33.3 33.3 Significantly positive Composition (%) 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 Total Table 5.2...

Ngày tải lên: 21/06/2014, 12:20

23 188 0
Organization and Development of Russian Business A Firm Level Analysis_4 potx

Organization and Development of Russian Business A Firm Level Analysis_4 potx

... enterprise Large owner Hired manager Significance of differences 0.000 b Independent (autonomous) enterprise Status of the JSC general director % by line 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 Total 4 81 278 ... 2006, p 13 ) Information arrays, available for experts, are related to specific groups of companies, such as, for example, a study of Rachinsky (2002) based on a sampling of 11 0 large Russian enterprises, ... intensity of a company’s modernization and restructuring The main trends for the formation of a cohort of CEOs and managerial teams are discovered on the basis of a comparative analysis of independent...

Ngày tải lên: 21/06/2014, 12:20

23 137 0
Organization and Development of Russian Business A Firm Level Analysis_5 doc

Organization and Development of Russian Business A Firm Level Analysis_5 doc

... companies of the developed countries increasing demands to management and the peculiarities of capital structure Factors of corporate management and restructuring play an important role at rank -and- file ... probability of choosing a form of control with separation of ownership from management, which adopts a value of 1 in the case of separation and one of “0” in the case of inseparability (that principal ... redistribution of ownership The managerial 9780230_ 217 287_09_cha07 dd 18 0 5 /14 /2009 3:50 :15 PM Corporate Control and Business Integration 18 1 corps had strong informational and organizational advantages...

Ngày tải lên: 21/06/2014, 12:20

23 193 0
Organization and Development of Russian Business A Firm Level Analysis_7 docx

Organization and Development of Russian Business A Firm Level Analysis_7 docx

... am grateful to Naohito Abe, Tatiana Dolgopyatova, Victoria Golikova, Satoshi Mizobata, Heiko Pleines, Fumikazu Sugiura, and Andrei Yakovlev as well as participants of the Joint Workshop of Japan ... indicator is the profitability (ratio of profit to sale) and returns on asset (ROA) indicators obtained on the basis of companies’ book reports from SKRIN and SPARK databases .10 The AVEPRO and ROAAVE ... indicators is justified by previous 9780230_ 217 287 _11 _cha09 dd 219 5 /14 /2009 11 :06 :15 AM 220 Organization and Development of Russian Business experience of an empirical analysis of Russian companies’...

Ngày tải lên: 21/06/2014, 12:20

23 216 0
Organization and Development of Russian Business A Firm Level Analysis_8 ppt

Organization and Development of Russian Business A Firm Level Analysis_8 ppt

... 1. 7 10 0. 0 10 0. 0 0.5 0.3 47.6 52 .1 3.9 7.7 0.8 1. 5 10 0. 0 10 0. 0 NA NA NA 14 .0 52.2 6 .1 0.5 10 0. 0 19 .0 55.9 5 .1 1.4 10 0. 0 14 .4 69.6 4.5 0.4 10 0. 0 Source: Compiled and calculated by the author based ... 29.5 11 .8 11 .3 14 .4 11 .5 7.8 9.8 8.6 7.8 8.6 10 .3 6 .1 6.6 24.0 24.0 29.3 13 .8 21. 7 26.2 10 .1 10.3 10 .5 9.6 9.5 9.5 4.6 11 .5 14 .4 8.9 11 .5 9.8 2.9 2.5 2.3 3.4 1. 1 6.6 10 0. 0 10 0. 0 10 0. 0 10 0. 0 10 0. 0 ... 10 0. 0 10 0. 0 30.2 21. 9 19 .0 29.0 10 0. 0 24.2 20.2 20.7 34.9 10 0. 0 22 .1 23.4 15 .8 38.7 10 0. 0 25.3 12 .6 20.7 41. 4 10 0. 0 26.7 21. 7 23.3 28.3 10 0. 0 23.0 14 .8 13 .1 13 .1 10 0. 0 Total (b) Geographical location...

Ngày tải lên: 21/06/2014, 12:20

23 184 0
Organization and Development of Russian Business A Firm Level Analysis_10 potx

Organization and Development of Russian Business A Firm Level Analysis_10 potx

... place after a period of chaos and uncertainty in the 19 90s allows us to draw a parallel between Russia and the China of the 19 80s rather than contemporary China It is noteworthy that empirical ... Journal of the Latin American and Caribbean Economic Association, 3: 16 1– 218 Megginson, W L., Nash, R C., & Van Randenborgh, M (19 94) The financial and operating performance of newly privatized ... the negative in the nearest future Acknowledgments I would like to thank my colleagues Tatiana Dolgopyatova, Larisa Gorbatova, Ichiro Iwasaki and Anna Lukyanova, as well as Lev Freinkman, Daniel...

Ngày tải lên: 21/06/2014, 12:20

23 177 0
Báo cáo y học: " Decorin and TGF-β1 polymorphisms and development of COPD in a general population" ppt

Báo cáo y học: " Decorin and TGF-β1 polymorphisms and development of COPD in a general population" ppt

... (12 ) (0) 13 6 (89) 10 (11 ) (1) 0.733 Decorin rs 111 06030 CC CA AA 996 (87) 14 2 (12 ) (1) 17 0 ( 91) (8) (1) 0. 217 Decorin rs1803343 AA AG GG 10 79 (94) 69 (6) (0) 17 3 (93) 13 (7) (0) 0.507 Abbreviations: ... pulmonary disease Am J Respir Crit Care Med 19 98, 15 8 :19 51- 1957 Pons AR, Sauleda J, Noguera A, Pons J, Barcelo B, Fuster A, Agusti AG: Decreased macrophage release of TGF-{beta} and TIMP -1 in ... transforming growth factor-beta1 production, fibrotic lung disease, and graft fibrosis after lung transplantation Transplantation 19 98, 66 :10 14 -10 20 Imai K, Hiramatsu A, Fukushima D, Pierschbacher...

Ngày tải lên: 12/08/2014, 16:20

8 384 0
Provision, discovery and development of ubiquitous services and applications

Provision, discovery and development of ubiquitous services and applications

... such as CoBrA [11 ] and CASS [12 ], the context data acquired from data sources (e.g sensors) is usually stored in a central place and managed via a DBMS This approach is useful for efficient data ... Realization Layer (Application Context Engine) Service Management Layer (Location-Aware Service Provision and Discovery Platform) Data Access Layer (DBMS, Middleware) Data Layer (Application Data, Context ... Pervasive Patterns and Applications (PATTERNS), pp 227–232, Athens, Greece, 2009 11 Jian Zhu and Hung Keng Pung, A Pragmatic Approach to Context-aware Service Organization and Discovery , In Enabling...

Ngày tải lên: 10/09/2015, 08:36

208 506 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

... B of the complex of HIV- 1 protease with OE inhibitor 0.05 11 21 31 41 51 61 71 91 81 Residue number B factor 80 chain A 60 40 20 0 11 21 31 41 51 61 71 81 91 20 40 chain B Fig The complex of HIV- 1 ... regions of Ramachandran plot ˚ average B for main chain atoms (A2 ) ˚ average B for side chain atoms (A2 ) 15 16 50 15 9 0 .18 0 .18 0.24 0. 011 1. 8 92.4 30 .1 31. 5 Ó FEBS 2004 HIV- 1 Protease Inhibitors ... between protease and inhibitor As an indicator of these hydrophobic interactions, distances between carbon atoms of inhibitor and the protease ˚ ˚ were calculated using cutoffs of 3.6 A and 4 .1 A [19 ]...

Ngày tải lên: 19/02/2014, 16:20

11 615 0
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx

Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx

... (National Cancer Institute, Bethesda, MD, USA) The protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA ... 1. 87 1. 81 1.87 1. 81 1.87 1. 81 2 .18 –2 .10 2.07–2.00 1. 97 1. 90 24.6 1. 81 19.0 21. 8 16 77 24.0–2.30 18 .1 20.0 16 62 24.6–2. 01 18.0 20.3 16 47 27.9 1. 81 18.8 222.4 16 97 22.6 1. 81 19.4 23.4 16 94 15 .0 1. 81 ... Asp 12 5 Asp 12 7 Gly 12 9 Asp 12 9 Asp Compound 25 Asp 25 Asp 27 Gly 29 Asp 48 Gly 12 5 Asp 12 5 Asp 12 5 Asp 12 7 Gly 12 9 Asp Compound 25 Asp 25 Asp 27 Gly 12 5 Asp 12 5 Asp 12 5 Asp 12 7 Gly 12 9 Asp 12 9...

Ngày tải lên: 08/03/2014, 02:20

13 439 0
w