... [12,13] The presence of avian and human type receptors on the tracheal epithelium of the species of birds even at Page of one day of age, indicate that both avian and human influenza viruses may utilize ... tissues does not indicate absence of influenza virus replication in lung tissues of domestic birds Many high and low pathogenic influenza virus infections of domestic and live bird market poultry ... Specification of receptor-binding phenotypes of influenza virus isolates from different hosts using synthetic sialylglycopolymers: non-egg-adapted human H1 and H3 influenza A and influenza B viruses...
Ngày tải lên: 12/08/2014, 04:21
... layers for the provision, discovery, and development of ubiquitous services and applications As a proof of concept, we demonstrate the use of the framework for the development of an information sharing ... area recently, including the development of embedded system and sensors, the design of system architecture and middleware, and the implementation of software agent and application framework This ... have to rewrite and redeploy the whole application 1.4 Problem Statement In this thesis, we address the problem of the provision, discovery and development of ubiquitous services and applications...
Ngày tải lên: 10/09/2015, 08:36
Lipidomics of influenza virus implications of host cell choline and sphingolipid metabolism
... knowledge of lipid involvement during influenza virus infections Introduction 1.2 The biology of influenza virus 1.2.1 The structure of influenza virus Influenza viruses are negative-sense single stranded ... Lipid profiling of influenza virus infected CHO-K1 and NRel-4 cells 118 4.2.3 Impact of DHAPAT deficiency on influenza virus replication 119 4.2.4 Impact of AGPS knockdown on influenza virus infection ... Introduction 1.2.2 The life cycle of influenza virus 1.2.2.1 Virus attachment and entry The lifecycle of influenza virus is initiated by the binding of influenza virus particles to the host cell...
Ngày tải lên: 09/09/2015, 10:12
Discovery and mechanism of action study of anti viral compounds for dengue virus
... BIOLOGY OF DENGUE VIRUS 1.2.1 Taxonomy of dengue virus Dengue virus (DENV) belongs to the family of Flaviviridae that consists of three genera, flavivirus (e.g dengue virus, West Nile virus, and ... (Skehel and Wiley 1998; Söllner 2004) They are found in a diverse family of viruses such as retroviruses, coronaviruses, paramyxoviruses, and filoviruses Class I fusion protein is composed of mostly ... Flaviviruses), Purple (Culex borne Flaviviruses), Blue (Tick borne Flaviviruses), Orange (No known vector Flaviviruses), Green (Pestiviruses), Cyan (Hepaciviruses) and Black (unassigned members of...
Ngày tải lên: 10/09/2015, 15:51
Design and development of major balance of plant components in solid oxide fuel cell system
... any SOFC system, the performance of the INER SOFC system is dependent not only on the design and operating conditions of the fuel cell stack, but also on the design and operating conditions of ... provided by the anode off-gas given an anode off-gas temperature of less than 650 oC, a cathode off-gas temperature of less than 390 oC, and a flame barrier temperature of less than 700 oC However, ... SOFC BOP system (S/C=1.7, O/C=0.3, fuel utilization = 64.2%, electrical conversion efficiency = 44%) Design of SOFC BOP components The BOP components of a SOFC system account for between 50% and...
Ngày tải lên: 05/09/2013, 16:10
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... between yeast and mammalian GPCR signaling pathways, this assay enables the quantitative measurement of receptor activity, or alternately the detection of its ligands Using known ligands of I7 OR ... related ligands strongly suggests the authenticity of its ligand binding and the maintenance of the coding ability at the receptor level Consequently this suggests that glycosylation of I7 OR is ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... Thermostability and thermoactivity of the CoADR phCoADR is stable for months at both )80 °C and )20 °C, and has half-lives of > 100 and 39 h at 85° and 95 °C, respectively Figure shows the dependence of the ... Addition of a second equivalent of NADPH to the EH2 form of phCoADR results in an increase in absorbance in the regions between 507 and 700 nm and 400 and 500 nm There is also an increase and FEBS ... above Thiols were quantified by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the CoA and dephospho CoA peaks, as described previously...
Ngày tải lên: 07/03/2014, 17:20
THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx
... AND DEVELOPMENT OF THE CEREAL PLANT 24 THE WHEAT BOOK THE WHEAT BOOK CHAPTER – THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT Tim Setter and ... formation of florets within each spikelet and, later, the regression and death of some florets and spikelets and the death of some tillers This phase is also the time of greatest dry mass increase and ... Mainstem and tillers 26: Mainstem and tillers 27: Mainstem and tillers 28: Mainstem and tillers 29: Mainstem and or more tillers Dough development Kernel no longer watery but still soft and dough-like...
Ngày tải lên: 08/03/2014, 23:20
history and development of higher education in india 1 5 ppt
Ngày tải lên: 09/03/2014, 17:20
Antibiotic Discovery and Development pptx
... antibiotic discovery and development process and provide the reader with a sense of how it is done and where things stand in 2011 The book begins with a solid historical review of the early years of ... potential leads, and the use of cell-based screens to identify inhibitors The role of both NMR and X-ray structure techniques in identifying inhibitors, mechanism of action studies, and their utility ... of an FtsZ cell division inhibitor, is presented as an excellent example of the process of modern antibiotic discovery Equally important to the refinement of lead interaction with the target and...
Ngày tải lên: 14/03/2014, 10:20
Origin and Development of Commercial and Islamic Banking Operations pot
... BC) of Lydia They were of electrum Origin and Development of Commercial and Islamic Banking Operations (a mixture of gold and silver) This must have encouraged the emergence and practices of banking ... ups and downs depending on the political and military conditions of the Republic In time of wars and disorder, inflation, financial stagnation and bankruptcy prevail and in times of peace and ... Bin Salih and above all two Jewish merchants and bankers: Yusuf Bin Finkhas and Harun Bin Imran of Baghdad who were appointed to the office of jahbadh of the Persian province Ahwaz and later...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... conjugation of the quencher and the fluorophore influenced neither the rate nor the site of hydrolysis of the peptide Sensitivity and selectivity of the Dabcyl– EVYAVES–Edans substrate and the activity of ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on the new substrate Results and Discussion Identification of ... at positions P1¢, P2 and P2¢, respectively Of the 14 residues at sites S1–S3¢ that contact the inhibitor in the crystal structure of inhibitor enzyme complexes of serralysin and alkaline protease,...
Ngày tải lên: 23/03/2014, 09:20
ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART pptx
... painted upon pottery 463 488.—Theoretical development of fret work 464 489.—Theoretical development of scroll work 465 [Pg 443] ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART By William ... the shape of the vessels employed at the time of the introduction of the art, and these depend, to a great extent, upon the kind and grade of culture of the people acquiring the art and upon the ... with the use of clay and a capacity in handling it that, with advancing culture, brought all nature within the reach of the potter and made it assist in the processes of variation and development...
Ngày tải lên: 28/03/2014, 20:20
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx
... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... responsibility for the use of these circuits and/ or software or of systems incorporating these circuits and/ or software lies with the reader, who must apply for any and all approvals and certifications ... provide an assortment of desired passband and gain characteristics selection and preparation of electrode placement on the subject, and by keeping the bandpass characteristics of the biopotential...
Ngày tải lên: 29/03/2014, 11:20
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... activity of LXR modulator compounds in target organs Several candidate biomarkers of LXR agonist exposure and activity have been identified in peripheral blood, and two of these (ABCA1 and ABCG1) ... elevation of ABCA1 and ABCG1 mRNAs reflected the potency of agonists to activate LXR receptors, rats were treated with a range of doses of GW3965 (Figure 2D) or LXR-623 (Figure 2E) Since the potency of ... with 0, 15 and 50 mpk/day of LXR-623 for days (n = per dose group) Blood was collected on day of dosing, and RNA was prepared from whole blood for gene expression analysis of ABCA1 and ABCG1 qPCR...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf
... optimally promote development and retention of motor skills and translate into long-term reduction in disability Also supporting a quantitative scientific understanding of mechanisms of post-stroke ... extend beyond orthopaedic, and impact recovery of motor control, we know that therapies cannot be passive and patients must be engaged Perhaps part of the 'magic' in the hands of the individual therapist ... disorders, and discusses current NBS plasticity protocols applied in clinical research Understanding stroke recovery This thematic series emphasizes the understanding and development of modern...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " An antigenic epitope of influenza virus nucleoprotein (NP) associated with polymeric forms of NP" ppt
... Structure of influenza virus ribonucleoprotein particles II Purified RNA-free influenza virus ribonucleoprotein forms structures that are indistinguishable from the intact influenza virus ribonucleoprotein ... oligomerization of influenza virus nucleoprotein Virology 1996, 223:51-56 Prokudina EN, Semenova NP, Chumakov VM, Rudneva IA: Transient disulfide bonds formation in conformational maturation of influenza virus ... for the detection of white-spot virus and yellowhead virus of penaeid shrimp J Virol Methods 2000, 84:175-179 Ito Ho, Nakashima T, So T, Hirata M, Inoue M: Immunodominance of conformation- dependent...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Simultaneous circulation of genotypes I and III of dengue virus 3 in Colombia" docx
... Philippines China Philippines Japan Malaysia Thailand Thailand Thailand Thailand Thailand Thailand Thailand Malaysia Thailand Thailand Thailand Thailand Bangladesh Bangladesh India SriLanka Martinique ... Philippi56 JaponImp73 Malaysia92 Thailand81 Thailand85 Thailand80 Thailan87a Thailan87b Thailand89 Thailand91 Malaysia94 Thailand97 Thailand96 Thailand92 Thailand94 Banglade01 Banglade00 India84 ... Liprandi F: Diversity and evolution of the envelope gene of dengue virus type Virology 2002, 303(1):110-119 Lanciotti RS, Gubler DJ, Trent DW: Molecular evolution and phylogeny of dengue-4 viruses...
Ngày tải lên: 20/06/2014, 01:20
Opal''''s Site Organization and Development of Russian Business_1 docx
... analysis of probability to obtain financial and organizational support from the state authorities Utility of business associations and their contribution to the establishment of standards and rules of ... impacts of business integration via the formation of holding companies and other types of business groups upon corporate governance and firm performance of affiliated firms; and (c) the role and ... boards of directors, and its chairs in 2001–2004 Comparison of JSCs with separation or combination of ownership and management Logistic regressions for shareholder choice of separated ownership and...
Ngày tải lên: 20/06/2014, 20:20