diffraction of a gaussian beam by multiple slits
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... an important probe for characterization of the nature of the aggregates Characteristic sigmoidal curves of amyloid-type aggregates, Fig Aggregation of a- synuclein (A) Samples were withdrawn after ... substantia nigra is a neuropathological hallmark of Parkinson’s disease This leads to a decreased level of dopamine in the striatum As a result, synaptic transmission is negatively affected in a- synuclein ... neuronal damage [33,34] The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia nigra pars Modulation...
- 11
- 754
- 0
Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx
Ngày tải lên :
08/03/2014, 08:20
... because of a low sample fraction and that some years the effect of the weather are higher Defoliation data should be shown in complementary tables not in balances Defoliation data are only available ... systematic way to fit table Acquisition of land and land area There exist no information divided by industries of land area and acquisition or disposal of land At the best such information can be made ... operational definition of unprotected natural forests The forest has to be at least 30 years older than the age of maturity and unaffected by human activity the latest 25 years An estimate gives a share...
- 48
- 520
- 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
Ngày tải lên :
23/03/2014, 15:20
... analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h The a- Syn alone sample was as a control The concentration of a- Syn was 200 lM and ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn ... protein aggregate The MTT reduction ability of the cell culture after addition of a- Syn or DA was also measured as a comparison The concentration of all a- Syn forms for the MTT assay was 10 lM Data...
- 12
- 414
- 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
Ngày tải lên :
29/03/2014, 21:20
... (pNPbGal), a- d-glucopyranose (pNPaGlc), N-acetyl a- d-glucosamine (pNPa GlcNAc), a- d-xylopyranose (pNPaXyl), a- d-mannopyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNPaAraf) ... trehalose, turanose, rafnose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St Louis, MO, USA) Galactomannans (Carubin ... AglC was tested towards mm pNPaGal, pNPaGalNAc, pNPaAra, pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha, pNPaXyl, and pNPbGal, and 0.4% galactomannans in 40 mm Na acetate pH 5.0, 0.02% BSA, for...
- 14
- 579
- 0
The Project Gutenberg eBook, The Adventures of a Forty-niner, by Daniel Knower potx
Ngày tải lên :
28/06/2014, 17:20
... protection of the patron saint of the city The head alcalder of the city was a Castilian Spaniard, a venerable-looking gentleman, white as any Northern man, evidently of Scandinavian descent, who ages ... ruins of what was once its great cathedral The freebooter Morgan is said to have plundered one of its altars of a million of gold and silver, and massacred many of its inhabitants, perpetrating ... have all been candid in your statements, and I shall be the same; I am going to California to deal Faro, the great American gambling game, and I don't care who knows it." Later on in my narrative,...
- 310
- 237
- 0
The Project Gutenberg eBook, The Adventures of a Forty-niner, by Daniel Knower pdf
Ngày tải lên :
28/06/2014, 17:20
... protection of the patron saint of the city The head alcalder of the city was a Castilian Spaniard, a venerable-looking gentleman, white as any Northern man, evidently of Scandinavian descent, who ages ... ruins of what was once its great cathedral The freebooter Morgan is said to have plundered one of its altars of a million of gold and silver, and massacred many of its inhabitants, perpetrating ... have all been candid in your statements, and I shall be the same; I am going to California to deal Faro, the great American gambling game, and I don't care who knows it." Later on in my narrative,...
- 310
- 344
- 0
The Project Gutenberg of The Romance of a Plain Man, by Ellen Glasgow pptx
Ngày tải lên :
28/06/2014, 17:21
... doubtfully, not negatively Above his short growth of beard his cheeks had warmed to a clear pink, and his foolish blue eyes were as soft as the eyes of a baby "Wall, I can't say she did that—exactly." "Then ... flames As the light fell over them, I saw that the woman was young and delicate and richly dressed, with a quantity of pale brown hair which the rain and wind had beaten flat against her small frightened ... 'twas because we'd had considerable trouble over the namin' of the first, which was yo' brother President That bein' the turn of the man of the family, I calculated that as a plain American citizen,...
- 1.1K
- 376
- 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx
Ngày tải lên :
28/06/2014, 19:20
... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... of constant multiples of logarithms of rational functions (iv., 1) If certain constants which are the roots of an algebraical equation are treated as known then the form of the integral can always ... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical...
- 86
- 262
- 1
Báo cáo khoa học: "Effect of a feedback control by early secondary xylem formation on the outcome of competition between leafy shoots in apple (Malus x domestica Borkh.)" ppt
Ngày tải lên :
09/08/2014, 02:21
... initial advance and cannot growing faster than shoot case is far from amplify it by The latter uncommon: amount to 40% of the total it may population, upon cultural conditions and treatments ... conducting capacity explains why shoot successfully opposes and stays abreast of its competitor sion cannot be discarded as part of the explanation However, cambial activity also interferes by long-term ... increases the probability of strong dominance of this latter; whereas bud near bud favors the occurrence of a fork (Jebari and Crabbe, 1984; Crabbe, 1985) This is, however, further complicated by...
- 4
- 254
- 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps
Ngày tải lên :
11/08/2014, 00:22
... when bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then, the aspartate was removed ... It also suggests a possibility that change of Tar localization can be inherited by descendant cells and this can affect their motility and therefore their phenotype This assay can potentially ... bacterial chemotaxis: receptor dimers in signalling arrays Molecular Microbiology 1998, 30:459-466 Manson MD, Armitage JP, Hoch JA, Macnab RM: Bacterial locomotion and signal transduction J Bacteriol...
- 4
- 166
- 0
báo cáo khoa học: " The elicitation of a systemic resistance by Pseudomonas putida BTP1 in tomato involves the stimulation of two lipoxygenase isoforms" potx
Ngày tải lên :
11/08/2014, 11:21
... TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - primer (CATGCCATGGGTGCTGTAGT TACAGTAAGGAAC) and primer (CCGCTCG AGTATCGATACACTATTTGGAAC) ... AGTATCGATACACTATTTGGAAC) - primer (CA TGCCATGGGTCACCACCACCACCACATGGCACT TGCTAAAGAAATTATG) and primer (CCGCTCGAG Page 12 of 15 TTATATCGATACACTATTTGGAAC) for TomLoxD; and primer (5’-CTAGCTAGCAGTTCTACTGAAAATTCCTC-3’) ... total RNA of Lycopersicon esculentum c “merveille des marchés” by using couples of primer 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC)...
- 15
- 661
- 0
Báo cáo y học: " Prompt improvement of a pressure ulcer by the administration of high viscosity semi-solid nutrition via a nasogastric tube in a man with tuberculosis: a case report" pdf
Ngày tải lên :
11/08/2014, 14:21
... Role of oral intake in maintenance of gut mass and disaccharide activity Gastroenterol 1974, 67(5):975-982 Kanie J, Suzuki Y, Iguchi A, Akatsu H, Yamamoto T, Shimokata H: Prevention of gastroesophageal ... nutrition of 1,200 kcal/day was started on the 21st day of admission (arrow c) Debridement of the sacral pressure ulcer was conducted on the 22nd day of admission (arrow d) was transferred to another ... nutrition in a short period of time Consent Written informed consent was obtained from the patient for publication of this case report and any Nakayama et al Journal of Medical Case Reports 2010,...
- 4
- 342
- 0
The construction and implementation of a dedicated beam line facility for ion beam bioimaging
Ngày tải lên :
09/09/2015, 10:15
... shows a typical cross section of a beam- sample interaction for a helium ion beam, in comparison with interactions for a gallium ion beam and an electron beam of the same beam diameter at 30 keV ... profile data are extracted from the two rectangular areas for beam spot size analysis in horizontal and vertical directions 83 Figure 3.20 Shape of the line scan in scanning a Gaussian ... environment of Au NPs; b) Total RBS Au image of HeLa cell cultured in an environment of Au NPs; c) Surface RBS Au image of HeLa cell cultured in an environment of Au NPs d) Subsurface RBS Au image of...
- 183
- 279
- 0
A behaviour based algorithm for encirclement of a dynamic target using multiple mobile robots
Ngày tải lên :
15/09/2015, 22:43
... and Arkin have shown that formation behaviour can be integrated into a motor-schema behaviour-based system with other navigational behaviours so that a robotic team can reach navigational goal, ... triangle (see Figure 2.1) rather than a circle is formed In a Reuleaux triangle, arcs ab, bc and ca are drawn with radii equal to D, from the vertices c, a and b Triangle abc is also an equilateral ... First of all, a field of 4m x 4m is selected and the target is always located at the centre The robots are initially located at a distance of 1.6 m from the target However, the orientation of each...
- 132
- 256
- 0
Optimization of a window frame by BEM and genetic algorithm
Ngày tải lên :
16/06/2016, 01:11
... introduction of new materials and additional layers of thermal insulation Because of the new regulations in national and international standards, the admissible value of the heat losses of the walls has ... while that of the exterior is mm, and geometry of the frame is approximated by a set of line segments The design variables are contractions, expansions and translations of the air cavities, and ... Optimization of a window frame by BEM and genetic algorithm Optimization of a window frame 565 Małgorzata Kro´l Department of Heat Supply, Ventilation and Dust Removal Technology, Silesian University...
- 17
- 344
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
Ngày tải lên :
25/10/2012, 09:56
... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... Science Data Service approved the collection and recording of the study data Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA) We used Table...
- 6
- 611
- 0
Simulation of a Multiple Input Multiple Output (MIMO) wireless system
Ngày tải lên :
20/11/2012, 11:36
... Fitzpatrick 2.4 Linear arrays Beamforming can be accomplished by using many different types of arrays, such as linear, circular and planar arrays I will only be considering linear arrays as shown ... the appropriate electric field value The ray list contains all of the data about rays propagating from a base station to a field point Each field point has a ray list associated with it A ray ... Fitzpatrick As can be seen, it is passed a particular base station, an image and its order, and also the field point As seen earlier a ray is made up of nodes, two of these nodes are always the base...
- 73
- 459
- 1
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch
Ngày tải lên :
15/10/2013, 16:11
... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has...
- 6
- 802
- 0
A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities
Ngày tải lên :
26/11/2013, 13:27
... example (4.73) We can try to build walls around us, and we can look inward, and we can respond by being frightened and angry about those disruptions [5] In grammar, parallelism is a balance of ... similar words, phrases, or clauses As shown in the above example, in (4.73) parallel structures are made up at clause level At lower level of parallel, word balancing with word appears popularly: ... DISCUSSIONS 4.1 LAYOUT FEATURES OF ENGLISH GRADUATION SPEECHES Layout is identified as the way in which the parts of something are arranged, and the layout of a graduation speech is the way in which...
- 13
- 839
- 2