difference between library and user defined functions in c

... proc_cuscrd = proc_cuscrd +(proc_cuscrd * i_perinc); UPDATE ordapplib.customer 11 SET cuscrd = proc_cuscrd WHERE CURRENT OF c1 ; SET numrec = numrec + 1; FETCH c1 INTO proc_cusnbr, proc_cuscrd; 12 END ... numrec = 0; fetch_loop: 1 LOOP FETCH c1 INTO proc_cusnbr, proc_cuscrd; IF SQLCODE = 0 THEN SET proc_cuscrd = proc_cuscrd * 1.2; UPDATE ordapplib.customer SET cuscrd = proc_cuscrd WHERE CURRENT ... Procedures, Triggers, and User- Defined Functions on DB2 Universal Database for iSeries SET numrec = 0; OPEN c1 ; 8 FETCH c1 INTO proc_cusnbr, proc_cuscrd; 9 WHILE at_end = 0 DO 10 SET proc_cuscrd...

Ngày tải lên: 17/03/2014, 00:20

... of LDC achieves domain independence by restricting itself to (a) a domain-independent. linguistically-motivated phrase-structure grammar [6] and (b) and the domain-specific files produced by ... that can occur in the "layered" domains of interest [1]. Finally, the macro file contains the meanings of modifiers, roughly in the form in which they were acquired using the specification ... paper is concerned only with vocabulary acquisition, which occurs in three stages. In Stage 1, Prep asks the user to name each ent~.ty, or conceptual data item, of the domain. As each entity...

Ngày tải lên: 17/03/2014, 19:21

Ngày tải lên: 24/11/2013, 08:11

... như c c đối tượng kh c trong Microsoft SQL Server mà chúng tôi đã trình bày trư c đây ở c c chương trư c, c c bạn c hai (2) c ch để c thể tạo mới một UDFs: sử dụng c c câu lệnh T-SQL ho c dùng ... bạn chỉ định kiểu này, UDFs trở nên rất giống c c Stored Procedure. Nó cho phép th c hiện c c câu lệnh SELECT ph c tạp, hơn nữa nó c n cho phép th c hiện c c câu lệnh logic kh c như UPDATE, INSERT ... đư c dựa trên c c tham số đầu vào đã nhận. Không chỉ UDFs mà tất c c c hàm nói chung (C c phiên bản SQL Server trư c đây cung c p c c hàm đư c cài đặt sẵn như getdate(), object_name(),… ) c ...

Ngày tải lên: 22/12/2013, 00:16

... SELECT statement. Creating User- Defined Functions You can create your own user- defined functions in SQL Server. For example, you might want to create your own function to compute the discounted ... You can also create functions using Enterprise Manager. You do this by clicking the right mouse button on the User Defined Functions node in the Databases folder and selecting New User Defined ... Using Scalar Functions Scalar functions return a single value. Listing 4.2 shows the DiscountPrice.sql script that creates the DiscountPrice() function, which returns the original price of...

Ngày tải lên: 26/01/2014, 07:20

... Src–SH2 binding protein in human stomach tissue. Interaction of Src and MVP was also observed in 253J stomach cancer cells. A subcellular localization study using immunofluorescence micros- copy ... overexpressed in various kinds of cancer cells. However, it is too premature to speculate what is the clinical significance of the interac- tion between Src and MVP in those cancer cells, which are overexpressing ... vivo in CHO and PC12 cells and phosphorylated by PKC and casein kinase II in vitro using speci c kinase agonist and inhibitors [31,32]. Although MVP has been recently reported to interact with...

Ngày tải lên: 07/03/2014, 12:20

... The user can assign nonmonotonic information to a nonmonotonic sort by calling a nonmonotonic definition as defined in the previous section. The ac- tual nonmonotonic rule occurring within ... nonmonotonic constructions. The main idea in their approach is that each node in a feature struc- ture consists of a nonmonotonic sort. Such sorts can contain two different kinds of information, ... the class; isa its parent in the hierarchy; requires a structure. Thus, each member in the inheritance hierarchy is called a class, which is defined by giving it a name and a parent in...

Ngày tải lên: 17/03/2014, 09:20

... 5.9AAAA5′- Rb: CCCC GC CC CC CC N 2 Transitional pH Transitional pH N 3/4 N 2 -3′ 6.4CGC5′- RET: CCC GC CCCCC GCCC Class I -3′ 6.6CA5´- c- Myc: CCC CCC CACCTT CCCCCC TCCCCA -3 ′ 6.6TTCCT5´- Bcl-2: CCCCCCC GCTCCCGC ... 6 A T 5′- 3′- -3′ -5′ A T A T A T A T A T T A T A T A T A G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C 14-base overhang 5-base overhang * * (i) (ii) (iii) (iv) AB Fig. 4. (A) Proposed equilibrating ... 6.6TTCCT5´- Bcl-2: CCCCCCC GCTCCCGC CCCCCCC GCGCCCG N 6/8 N 2/5 N 6/7 Class II 5′ 3′ 3′ 5′ c- Myc Bcl-2 VEGF RET Rb 3′ 5′ 3′ 5′ 3′ 5′ Fig. 3. Sequences and folding patterns of i-motifs in the two proposed classes of...

Ngày tải lên: 23/03/2014, 03:20

... EV-associated HPVs interacts with RS domain-containing splicing factors via its RS dipeptide-rich hinge. The interaction between an EV HPV E2 protein and a set of canonical SR proteins, including SRp20, ... pro- teins and RS domain-containing small nuclear ribonu- cleoprotein (snRNP) components [9]. Functional investigation of this E2 protein has indicated that its RS-rich hinge domain can facilitate ... ligand-induced ceramide accumula- tion, which results in dephosphorylation of SR pro- teins and, hence, changes in alternative splicing patterns [73]. Similarly, infection of vaccinia virus induces...

Ngày tải lên: 23/03/2014, 06:20

... MM1028rt for AAACGTTGCTGACGTGCACAC MM1028rt rev CGATATTCTCAAGCCCAAGCC MM2184 TBP3 MM2184rt for TGATGGAGTCTGGGTTGGAAG MM2184rt rev AGCCAGATTGATTATGGCCGC MM1772 TFB MM1772rt for ATTCGGACACCCTTGAAAGGG MM1772rt ... NaCl D NrpRI NrpRII NrpRI + NrpRII NrpRI + NrpRII 2-OG c 1 c 2 c 3 c 1 c 2 c 3 c 1 c 2 c 3 1234 56 123456 1 2 3 4 5 6 1 2 3 4 5 6 c 1 c 2 c 3 NrpRI NrpRII NrpRI + NrpRII NrpRI + NrpRII 2 m M 2-OG c 1 c 2 c 3 c 1 c 2 c 3 c 1 c 2 c 3 Fig. ... using the primer set glnK 1 for (5Â-TTG AACCCGGGTTGATCGAATTC-3Â) and glnK 1 rev (5 Â-AC GAAGATCTTTCCGCTTCCAAC-3Â). After gel purica- tion, the 418-bp PCR products obtained were end-labelled using...

Ngày tải lên: 29/03/2014, 21:20

... to amplify the coding sequence and incorporate appropriate restriction sites were: ZfaB2-5Â, GCAGAAGAGGCCCAG ACTCCATATGGAC; ZfaB2-3Â, CTCGAGAGTTGACGT TTAGCATCTTTAC. The sequence of the expression clone was ... amplification of genomic DNA: sense 5Â-GCCGAC GTGATCTCCTCATT-3Â; antisense 5Â-CCAACAGGGA CACGGTATTT-3Â. Cycle parameters were: 94 C for 15 s, 55 C for 30 s, and 72 C for 1 min. Aliquots from each reaction ... Gene sharing by delta-crystallin and argininosuc- cinate lyase. Proc Natl Acad Sci USA 85, 3479–3483. 33 Hochachka PW & Somero GN (2002) Biochemical Adaptation: Mechanism and Process in Physiological Evolution....

Ngày tải lên: 30/03/2014, 11:20

Ngày tải lên: 18/06/2014, 17:20

Ngày tải lên: 20/06/2014, 15:20

Ngày tải lên: 20/06/2014, 22:20

Ngày tải lên: 09/08/2014, 13:21

Ngày tải lên: 09/08/2014, 23:20

Ngày tải lên: 12/08/2014, 17:21

Ngày tải lên: 14/08/2014, 19:22

Ngày tải lên: 23/10/2014, 14:27

Ngày tải lên: 23/10/2014, 14:27